ZFIN ID: ZDB-MRPHLNO-100503-2
Morpholino Name: MO3-vsx2
Target: vsx2 (1)
Previous Name: vsx2aspMO1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ACATCATCTGAATCTGAGCTGGCAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-vsx2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-vsx2
Expressed Gene Anatomy Figures
dmbx1a Fig. 3 with image from Wong et al., 2015
PHENOTYPE
Phenotype resulting from MO3-vsx2
Phenotype Figures
eye decreased size, abnormal Fig. 3 with image from Wong et al., 2015
head dmbx1a expression increased amount, abnormal Fig. 3 with image from Wong et al., 2015
retina dmbx1a expression increased amount, abnormal Fig. 3 with image from Wong et al., 2015
retina cell proliferation involved in compound eye morphogenesis decreased occurrence, abnormal Fig. 4 with image from Wong et al., 2015

Phenotype of all Fish created by or utilizing MO3-vsx2
Phenotype Fish Conditions Figures
retina cell proliferation involved in compound eye morphogenesis decreased occurrence, abnormal AB + MO3-vsx2 standard conditions Fig. 4 with image from Wong et al., 2015
eye decreased size, abnormal AB + MO3-vsx2 standard conditions Fig. 3 with image from Wong et al., 2015
head dmbx1a expression increased amount, abnormal AB + MO3-vsx2 standard conditions Fig. 3 with image from Wong et al., 2015
retina dmbx1a expression increased amount, abnormal AB + MO3-vsx2 standard conditions Fig. 3 with image from Wong et al., 2015
eye decreased size, abnormal WT + MO3-vsx2 + MO4-vsx2 standard conditions Fig. 11 with image from Vitorino et al., 2009
Muller cell decreased amount, abnormal nns3Tg; nns5Tg + MO3-vsx2 + MO4-vsx2 standard conditions Fig. 13 with image from Vitorino et al., 2009
retinal bipolar neuron decreased amount, abnormal nns3Tg; nns5Tg + MO3-vsx2 + MO4-vsx2 standard conditions Fig. 13 with image from Vitorino et al., 2009
OTHER MO3-vsx2 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)