header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100503-2
Morpholino Name: MO3-vsx2
Target: vsx2 (1)
Previous Name: vsx2aspMO1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ACATCATCTGAATCTGAGCTGGCAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-vsx2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-vsx2
Expressed Gene Anatomy Figures
dmbx1a Fig. 3 with image from Wong et al., 2015
PHENOTYPE
Phenotype resulting from MO3-vsx2
Phenotype of all Fish created by or utilizing MO3-vsx2
OTHER MO3-vsx2 MORPHOLINO PAGES No links to external sites
CITATIONS (2)