ZFIN ID: ZDB-MRPHLNO-100125-1
Morpholino Name: MO3-lef1
Target: lef1 (1)
Sequence:
5' - CTCCACCTGACAACTGCGGCATTTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-lef1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-lef1
Expressed Gene Anatomy Figures
dlx2a Fig. 4 with image from Nagayoshi et al., 2008
fgf8a Fig. 4 with image from Nagayoshi et al., 2008
fgf10a Fig. 4 with image from Nagayoshi et al., 2008
fgf24 Fig. 4 with image from Nagayoshi et al., 2008
wnt3a Fig. 4 with image from Nagayoshi et al., 2008
PHENOTYPE
Phenotype resulting from MO3-lef1
Phenotype Figures
neuromast decreased distance neuromast, abnormal Fig. 1 with image from Matsuda et al., 2013
neuromast has fewer parts of type neuromast hair cell, abnormal Fig. 2 with image from Wada et al., 2013
neuromast deposition process quality, abnormal Fig. 1 with imageFig. 3 with image from Matsuda et al., 2013
posterior lateral line development decreased process quality, abnormal Fig. 1 with imageFig. 4 with image from Valdivia et al., 2011
posterior lateral line neuromast decreased amount, abnormal Fig. 1 with imageFig. 4 with image from Valdivia et al., 2011
posterior lateral line neuromast primordium migration process quality, abnormal Fig. 3 with image from Matsuda et al., 2013
posterior lateral line primordium cell division decreased process quality, abnormal Fig. 2 with image from Matsuda et al., 2013
posterior lateral line primordium cell population proliferation decreased process quality, abnormal Fig. 2 with image from Matsuda et al., 2013
Wnt signaling pathway decreased process quality, abnormal Fig. 1 with image from Valdivia et al., 2011

Phenotype of all Fish created by or utilizing MO3-lef1
Phenotype Fish Conditions Figures
posterior lateral line neuromast decreased amount, abnormal WT + MO3-lef1 standard conditions Fig. 1 with image from Valdivia et al., 2011
neuromast has fewer parts of type neuromast hair cell, abnormal WT + MO3-lef1 standard conditions Fig. 2 with image from Wada et al., 2013
posterior lateral line development decreased process quality, abnormal WT + MO3-lef1 standard conditions Fig. 1 with image from Valdivia et al., 2011
Wnt signaling pathway decreased process quality, abnormal ia4Tg + MO3-lef1 standard conditions Fig. 1 with image from Valdivia et al., 2011
posterior lateral line development decreased process quality, abnormal zf106Tg + MO3-lef1 standard conditions Fig. 4 with image from Valdivia et al., 2011
posterior lateral line neuromast decreased amount, abnormal zf106Tg + MO3-lef1 standard conditions Fig. 4 with image from Valdivia et al., 2011
neuromast decreased distance neuromast, abnormal zf106Tg + MO3-lef1 + MO4-tp53 standard conditions Fig. 1 with image from Matsuda et al., 2013
posterior lateral line neuromast primordium migration process quality, abnormal zf106Tg + MO3-lef1 + MO4-tp53 standard conditions Fig. 3 with image from Matsuda et al., 2013
neuromast deposition process quality, abnormal zf106Tg + MO3-lef1 + MO4-tp53 standard conditions Fig. 1 with imageFig. 3 with image from Matsuda et al., 2013
posterior lateral line primordium cell division decreased process quality, abnormal zf106Tg + MO3-lef1 + MO4-tp53 standard conditions Fig. 2 with image from Matsuda et al., 2013
posterior lateral line primordium cell population proliferation decreased process quality, abnormal zf106Tg + MO3-lef1 + MO4-tp53 standard conditions Fig. 2 with image from Matsuda et al., 2013
pectoral fin decreased size, abnormal tcf7nkhg21cEt/nkhg21cEt + MO3-lef1 standard conditions Fig. 4 with image from Nagayoshi et al., 2008
posterior lateral line primordium has number of posterior lateral line primordium cell, ameliorated amotl2afu46/fu46; zf106Tg + MO3-lef1 standard conditions Fig. 7 with image from Agarwala et al., 2015
posterior lateral line development decreased process quality, abnormal apczf134/zf134; zf106Tg + MO3-lef1 standard conditions Fig. 7 with image from Valdivia et al., 2011
posterior lateral line primordium has fewer parts of type posterior lateral line primordium cell, abnormal yap1fu48/fu48; zf106Tg + MO3-lef1 standard conditions Fig. 7 with image from Agarwala et al., 2015
posterior lateral line primordium has fewer parts of type posterior lateral line primordium cell, abnormal amotl2afu46/fu46; yap1fu48/fu48; zf106Tg + MO3-lef1 standard conditions Fig. 7 with image from Agarwala et al., 2015
OTHER MO3-lef1 MORPHOLINO PAGESNo links to external sites
CITATIONS (5)