Morpholino

MO3-emx3

ID
ZDB-MRPHLNO-090826-6
Name
MO3-emx3
Previous Names
  • emx3MOupstream (1)
Target
Sequence
5' - GTCACTCTGAACCCGATGATGGAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-emx3
No data available
Phenotype
Phenotype resulting from MO3-emx3
No data available
Phenotype of all Fish created by or utilizing MO3-emx3
Phenotype Fish Conditions Figures
dorsal telencephalon morphology, abnormal AB + MO2-emx3 + MO3-emx3 + MO4-tp53 heat shock Fig. 6 with image from Viktorin et al., 2009
supraoptic tract fasciculation, abnormal WT + MO2-emx3 + MO3-emx3 + MO4-tp53 standard conditions Fig. 5 with image from Viktorin et al., 2009
cranial nerve I defasciculated, abnormal WT + MO2-emx3 + MO3-emx3 + MO4-tp53 standard conditions Fig. 5 with image from Viktorin et al., 2009
axonal fasciculation disrupted, abnormal WT + MO2-emx3 + MO3-emx3 + MO4-tp53 standard conditions Fig. 5 with image from Viktorin et al., 2009
anterior commissure aplastic, abnormal WT + MO2-emx3 + MO3-emx3 + MO4-tp53 standard conditions Fig. 5 with image from Viktorin et al., 2009
dorsal telencephalon morphology, abnormal WT + MO2-emx3 + MO3-emx3 + MO4-tp53 standard conditions Fig. 3 with imageFig. 4 with image from Viktorin et al., 2009
telencephalon ventricular zone increased width, abnormal WT + MO2-emx3 + MO3-emx3 + MO4-tp53 standard conditions Fig. 5 with image from Viktorin et al., 2009
glomerular layer decreased size, abnormal WT + MO2-emx3 + MO3-emx3 + MO4-tp53 standard conditions Fig. 5 with image from Viktorin et al., 2009
olfactory bulb development disrupted, abnormal WT + MO2-emx3 + MO3-emx3 + MO4-tp53 standard conditions Fig. 5 with image from Viktorin et al., 2009
axon extension disrupted, abnormal WT + MO2-emx3 + MO3-emx3 + MO4-tp53 standard conditions Fig. 5 with image from Viktorin et al., 2009
supraoptic tract decreased thickness, abnormal WT + MO2-emx3 + MO3-emx3 + MO4-tp53 standard conditions Fig. 5 with image from Viktorin et al., 2009
forebrain neuron differentiation disrupted, abnormal WT + MO2-emx3 + MO3-emx3 + MO4-tp53 standard conditions Fig. 4 with image from Viktorin et al., 2009
dorsal telencephalon morphology, abnormal b1202Tg/+ + MO2-emx3 + MO3-emx3 + MO4-tp53 heat shock Fig. 6 with image from Viktorin et al., 2009
dorsal telencephalon morphology, abnormal WT + MO1-emx1 + MO1-emx2 + MO2-emx1 + MO2-emx2 + MO2-emx3 + MO3-emx3 + MO4-tp53 standard conditions Fig. 3 with image from Viktorin et al., 2009
Citations