Morpholino

MO1-casp3a

ID
ZDB-MRPHLNO-081016-1
Name
MO1-casp3a
Previous Names
  • caspase-MO (1)
Target
Sequence
5' - TTGCGTCCACACAGTCTCCGTTCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-casp3a
Expressed Gene Anatomy Figures
casp3a Fig. 11 from Yamashita et al., 2008
Phenotype
Phenotype resulting from MO1-casp3a
Phenotype of all Fish created by or utilizing MO1-casp3a
Phenotype Fish Conditions Figures
retinal ganglion cell axon physical object quality, abnormal WT + MO1-casp3a standard conditions Fig. 1 with image from Campbell et al., 2013
retinal ganglion cell cysteine-type endopeptidase activity decreased occurrence, abnormal WT + MO1-casp3a standard conditions Fig. 1 with image from Campbell et al., 2013
epiboly involved in gastrulation with mouth forming second disrupted, abnormal WT + MO1-casp3a standard conditions Fig. 11 from Yamashita et al., 2008
epiboly involved in gastrulation with mouth forming second arrested, abnormal WT + MO1-casp3a standard conditions text only from Yamashita et al., 2008
retinal ganglion cell collateral sprouting in absence of injury occurrence, abnormal WT + MO1-casp3a standard conditions Fig. 4 with image from Campbell et al., 2013
retinal ganglion cell axon collateral physical object quality, abnormal WT + MO1-casp3a standard conditions Fig. 1 with imageFig. 4 with image from Campbell et al., 2013
whole organism wholly dorsalized, abnormal WT + MO1-casp3a standard conditions Fig. 11 from Yamashita et al., 2008
retinal ganglion cell neuron remodeling decreased process quality, abnormal WT + MO1-casp3a standard conditions Fig. 4 with image from Campbell et al., 2013
epiboly involved in gastrulation with mouth forming second arrested, abnormal zf111Tg/+ + MO1-casp3a standard conditions text only from Yamashita et al., 2008
optic tectum microglial cell decreased amount, abnormal hdb2Tg + MO1-casp3a chemical treatment: Z-Val-Ala-Asp(OMe)-CH2F Fig. 2 with image from Casano et al., 2016
retinal ganglion cell collateral sprouting in absence of injury increased occurrence, abnormal robo2ti272z/+ + MO1-casp3a standard conditions Fig. 6 with image from Campbell et al., 2013
retinal ganglion cell axon increased branchiness, abnormal robo2ti272z/+ + MO1-casp3a standard conditions Fig. 6 with image from Campbell et al., 2013
retinal ganglion cell axon has extra parts of type retinal ganglion cell presynaptic active zone, abnormal robo2ti272z/+ + MO1-casp3a standard conditions Fig. 6 with image from Campbell et al., 2013
retinal ganglion cell axon collateral increased length, abnormal robo2ti272z/+ + MO1-casp3a standard conditions Fig. 6 with image from Campbell et al., 2013
retinal ganglion cell axon has extra parts of type retinal ganglion cell presynaptic active zone, abnormal WT + MO1-casp3a + MO1-slit1a standard conditions Fig. 6 with image from Campbell et al., 2013
retinal ganglion cell axon increased branchiness, abnormal WT + MO1-casp3a + MO1-slit1a standard conditions Fig. 6 with image from Campbell et al., 2013
retinal ganglion cell neuron remodeling decreased process quality, abnormal WT + MO1-casp3a + MO1-slit1a standard conditions Fig. 8 with image from Campbell et al., 2013
retinal ganglion cell collateral sprouting in absence of injury increased occurrence, abnormal WT + MO1-casp3a + MO1-slit1a standard conditions Fig. 6 with image from Campbell et al., 2013
retinal ganglion cell axon collateral increased length, abnormal WT + MO1-casp3a + MO1-slit1a standard conditions Fig. 6 with image from Campbell et al., 2013
retinal ganglion cell collateral sprouting in absence of injury occurrence, abnormal WT + MO1-casp3a + MO1-slit1a standard conditions Fig. 8 with image from Campbell et al., 2013
retinal ganglion cell axon collateral physical object quality, abnormal WT + MO1-casp3a + MO1-slit1a standard conditions Fig. 8 with image from Campbell et al., 2013
brain apoptotic process decreased occurrence, abnormal WT + MO1-casp3a + MO1-spi1b chemical treatment: Z-Val-Ala-Asp(OMe)-CH2F Fig. 2 with image from Casano et al., 2016
retinal ganglion cell neuron remodeling decreased process quality, abnormal WT + MO1-casp3a + MO3-robo2 standard conditions Fig. 8 with image from Campbell et al., 2013
retinal ganglion cell collateral sprouting in absence of injury occurrence, abnormal WT + MO1-casp3a + MO3-robo2 standard conditions Fig. 8 with image from Campbell et al., 2013
retinal ganglion cell axon collateral physical object quality, abnormal WT + MO1-casp3a + MO3-robo2 standard conditions Fig. 8 with image from Campbell et al., 2013
microglial cell size, ameliorated slc37a2t30301/t30301; zf148Tg; zf149Tg + MO1-casp3a chemical treatment by environment: Z-Val-Ala-Asp(OMe)-CH2F Fig. 2 with image from Villani et al., 2019
brain apoptotic process decreased rate, abnormal slc37a2t30301/t30301; zf148Tg; zf149Tg + MO1-casp3a chemical treatment by environment: Z-Val-Ala-Asp(OMe)-CH2F Fig. 2 with image from Villani et al., 2019
microglial cell phagocytic vesicle diameter, ameliorated slc37a2t30301/t30301; zf148Tg; zf149Tg + MO1-casp3a chemical treatment by environment: Z-Val-Ala-Asp(OMe)-CH2F Fig. 2 with image from Villani et al., 2019
Citations