header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-071210-1
Morpholino Name: MO6-myod1
Target: myod1 (1)
Previous Names: MO6-myod, myod-splMO E2I2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TTTCGAGCAAACTTACCATTTGGTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO6-myod1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO6-myod1
Expressed Gene Anatomy Figures
desma Fig. 1 with image from Maves et al., 2007
egr2b Fig. 1 with image from Maves et al., 2007
myod1 Fig. 1 with imageFig. S3 with image from Maves et al., 2007
myog Fig. 1 with image from Maves et al., 2007
PHENOTYPE
Phenotype resulting from MO6-myod1
Phenotype of all Fish created by or utilizing MO6-myod1
OTHER MO6-myod1 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)