Morpholino

MO1-amotl2a

ID
ZDB-MRPHLNO-070530-2
Name
MO1-amotl2a
Previous Names
  • amotl2MO1 (1)
  • MO1-amotl2
Target
Sequence
5' - CTGATGATTCCTCTGCCGTTCTCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-amotl2a
Expressed Gene Anatomy Figures
chrd Fig. 1 from Li et al., 2012
ctslb Fig. 4 with image from Huang et al., 2007
dharma Fig. 1 from Li et al., 2012
dlx3b Fig. 4 with image from Huang et al., 2007
eve1 Fig. 1 from Li et al., 2012
tbxta Fig. 4 with image from Huang et al., 2007
Phenotype
Phenotype resulting from MO1-amotl2a
Phenotype Fish Figures
angiogenesis disrupted, abnormal y1Tg + MO1-amotl2a Fig. 1 from Wang et al., 2011
blastodisc anatomical margin dharma expression increased amount, abnormal TU + MO1-amotl2a Fig. 1 from Li et al., 2012
blastodisc anatomical margin dharma expression increased distribution, abnormal TU + MO1-amotl2a Fig. 1 from Li et al., 2012
blastodisc anatomical margin dharma expression spatial pattern, abnormal TU + MO1-amotl2a Fig. 1 from Li et al., 2012
blood vessel unlumenized, abnormal y1Tg + MO1-amotl2a Fig. 1 from Wang et al., 2011
cell migration disrupted, abnormal TU + MO1-amotl2a Fig. 5 with image,  text only from Huang et al., 2007
convergent extension decreased rate, abnormal TU + MO1-amotl2a Fig. 4 with image from Huang et al., 2007
cortical actin cytoskeleton organization disrupted, abnormal TU + MO1-amotl2a Fig. 5 with image from Huang et al., 2007
dorsal aorta closed, abnormal s843Tg; sd2Tg + MO1-amotl2a Fig. 1 from Hultin et al., 2014
dorsal aorta constricted, abnormal y1Tg + MO1-amotl2a Fig. 2 from Hultin et al., 2014
dorsal aorta decreased diameter, abnormal y1Tg + MO1-amotl2a Fig. 2 from Hultin et al., 2014
dorsal aorta blood vessel lumenization decreased process quality, abnormal s843Tg; sd2Tg + MO1-amotl2a Fig. 1,  Fig. 2 from Hultin et al., 2014
dorsal aorta morphogenesis decreased process quality, abnormal y1Tg + MO1-amotl2a Fig. 1,  Fig. 2 from Hultin et al., 2014
dorsal longitudinal anastomotic vessel aplastic, abnormal y1Tg + MO1-amotl2a Fig. 1 from Wang et al., 2011
dorsal longitudinal anastomotic vessel closed, abnormal s843Tg; sd2Tg + MO1-amotl2a Fig. 1 from Hultin et al., 2014
embryonic pattern specification disrupted, abnormal TU + MO1-amotl2a Fig. 4 with image from Huang et al., 2007
filopodium assembly disrupted, abnormal TU + MO1-amotl2a Fig. 5 with image from Huang et al., 2007
germ ring chrd expression increased distribution, abnormal TU + MO1-amotl2a Fig. 1 from Li et al., 2012
germ ring chrd expression mislocalised, abnormal TU + MO1-amotl2a Fig. 1 from Li et al., 2012
germ ring chrd expression spatial pattern, abnormal TU + MO1-amotl2a Fig. 1 from Li et al., 2012
intersegmental vein closed, abnormal s843Tg; sd2Tg + MO1-amotl2a Fig. 1 from Hultin et al., 2014
intersegmental vessel decreased length, abnormal y1Tg + MO1-amotl2a Fig. 1 from Wang et al., 2011
intersegmental vessel blood vessel endothelial cell decreased amount, abnormal y7Tg + MO1-amotl2a Fig. 3 from Wang et al., 2011
neural plate increased width, abnormal TU + MO1-amotl2a Fig. 4 with image from Huang et al., 2007
polster mislocalised, abnormal TU + MO1-amotl2a Fig. 4 with image from Huang et al., 2007
post-vent region curved ventral, abnormal TU + MO1-amotl2a Fig. 1 from Li et al., 2012
post-vent region decreased size, abnormal TU + MO1-amotl2a Fig. 1 from Li et al., 2012
posterior lateral line primordium has extra parts of type posterior lateral line primordium cell, abnormal zf106Tg + MO1-amotl2a Fig. 6 with image from Agarwala et al., 2015
posterior lateral line primordium cell population proliferation increased occurrence, abnormal zf106Tg + MO1-amotl2a Fig. 3 with image,  Fig. 6 with image from Agarwala et al., 2015
posterior lateral line primordium posterior lateral line neuromast primordium migration decreased speed, abnormal zf106Tg + MO1-amotl2a Fig. 2 with image from Agarwala et al., 2015
posterior lateral line primordium posterior region has extra parts of type posterior lateral line primordium cell, abnormal zf106Tg + MO1-amotl2a Fig. 3 with image from Agarwala et al., 2015
protein phosphorylation decreased occurrence, abnormal y1Tg + MO1-amotl2a Fig. 5 from Wang et al., 2011
trunk vasculature blood circulation decreased occurrence, abnormal s843Tg; sd2Tg + MO1-amotl2a Fig. 1 from Hultin et al., 2014
whole organism decreased length, abnormal TU + MO1-amotl2a Fig. 4 with image from Huang et al., 2007
whole organism lacks all parts of type parachordal vessel, abnormal y1Tg + MO1-amotl2a Fig. 1 from Wang et al., 2011
whole organism wholly dorsalized, abnormal TU + MO1-amotl2a Fig. 4 with image from Huang et al., 2007
whole organism cortical actin cytoskeleton decreased mass density, abnormal TU + MO1-amotl2a Fig. 5 with image from Huang et al., 2007
whole organism cortical actin cytoskeleton disorganized, abnormal TU + MO1-amotl2a Fig. 5 with image from Huang et al., 2007
whole organism DEL cellular motility, abnormal TU + MO1-amotl2a text only from Huang et al., 2007
whole organism EVL cellular motility, abnormal TU + MO1-amotl2a text only from Huang et al., 2007
whole organism forerunner cell group cellular motility, abnormal TU + MO1-amotl2a text only from Huang et al., 2007
whole organism ventral region eve1 expression decreased amount, abnormal TU + MO1-amotl2a Fig. 1 from Li et al., 2012
whole organism yolk syncytial layer cellular motility, abnormal TU + MO1-amotl2a text only from Huang et al., 2007
Phenotype of all Fish created by or utilizing MO1-amotl2a
Phenotype Fish Conditions Figures
cell migration disrupted, abnormal TU + MO1-amotl2a standard conditions Fig. 5 with image,  text only from Huang et al., 2007
filopodium assembly disrupted, abnormal TU + MO1-amotl2a standard conditions Fig. 5 with image from Huang et al., 2007
whole organism yolk syncytial layer cellular motility, abnormal TU + MO1-amotl2a standard conditions text only from Huang et al., 2007
convergent extension decreased rate, abnormal TU + MO1-amotl2a standard conditions Fig. 4 with image from Huang et al., 2007
whole organism forerunner cell group cellular motility, abnormal TU + MO1-amotl2a standard conditions text only from Huang et al., 2007
blastodisc anatomical margin dharma expression spatial pattern, abnormal TU + MO1-amotl2a standard conditions Fig. 1 from Li et al., 2012
whole organism EVL cellular motility, abnormal TU + MO1-amotl2a standard conditions text only from Huang et al., 2007
neural plate increased width, abnormal TU + MO1-amotl2a standard conditions Fig. 4 with image from Huang et al., 2007
post-vent region decreased size, abnormal TU + MO1-amotl2a standard conditions Fig. 1 from Li et al., 2012
whole organism wholly dorsalized, abnormal TU + MO1-amotl2a standard conditions Fig. 4 with image from Huang et al., 2007
polster mislocalised, abnormal TU + MO1-amotl2a standard conditions Fig. 4 with image from Huang et al., 2007
embryonic pattern specification disrupted, abnormal TU + MO1-amotl2a standard conditions Fig. 4 with image from Huang et al., 2007
whole organism cortical actin cytoskeleton disorganized, abnormal TU + MO1-amotl2a standard conditions Fig. 5 with image from Huang et al., 2007
blastodisc anatomical margin dharma expression increased distribution, abnormal TU + MO1-amotl2a standard conditions Fig. 1 from Li et al., 2012
whole organism ventral region eve1 expression decreased amount, abnormal TU + MO1-amotl2a standard conditions Fig. 1 from Li et al., 2012
post-vent region curved ventral, abnormal TU + MO1-amotl2a standard conditions Fig. 1 from Li et al., 2012
blastodisc anatomical margin dharma expression increased amount, abnormal TU + MO1-amotl2a standard conditions Fig. 1 from Li et al., 2012
whole organism DEL cellular motility, abnormal TU + MO1-amotl2a standard conditions text only from Huang et al., 2007
whole organism cortical actin cytoskeleton decreased mass density, abnormal TU + MO1-amotl2a standard conditions Fig. 5 with image from Huang et al., 2007
germ ring chrd expression mislocalised, abnormal TU + MO1-amotl2a standard conditions Fig. 1 from Li et al., 2012
germ ring chrd expression increased distribution, abnormal TU + MO1-amotl2a standard conditions Fig. 1 from Li et al., 2012
germ ring chrd expression spatial pattern, abnormal TU + MO1-amotl2a standard conditions Fig. 1 from Li et al., 2012
whole organism decreased length, abnormal TU + MO1-amotl2a standard conditions Fig. 4 with image from Huang et al., 2007
cortical actin cytoskeleton organization disrupted, abnormal TU + MO1-amotl2a standard conditions Fig. 5 with image from Huang et al., 2007
intersegmental vessel decreased length, abnormal y1Tg + MO1-amotl2a standard conditions Fig. 1 from Wang et al., 2011
dorsal longitudinal anastomotic vessel aplastic, abnormal y1Tg + MO1-amotl2a standard conditions Fig. 1 from Wang et al., 2011
dorsal aorta morphogenesis decreased process quality, abnormal y1Tg + MO1-amotl2a standard conditions Fig. 2 from Hultin et al., 2014
whole organism lacks all parts of type parachordal vessel, abnormal y1Tg + MO1-amotl2a standard conditions Fig. 1 from Wang et al., 2011
angiogenesis disrupted, abnormal y1Tg + MO1-amotl2a standard conditions Fig. 1 from Wang et al., 2011
dorsal aorta blood vessel lumenization decreased process quality, abnormal y1Tg + MO1-amotl2a standard conditions Fig. 2 from Hultin et al., 2014
blood vessel unlumenized, abnormal y1Tg + MO1-amotl2a standard conditions Fig. 1 from Wang et al., 2011
dorsal aorta constricted, abnormal y1Tg + MO1-amotl2a standard conditions Fig. 2 from Hultin et al., 2014
dorsal aorta decreased diameter, abnormal y1Tg + MO1-amotl2a standard conditions Fig. 2 from Hultin et al., 2014
protein phosphorylation decreased occurrence, abnormal y1Tg + MO1-amotl2a standard conditions Fig. 5 from Wang et al., 2011
intersegmental vessel blood vessel endothelial cell decreased amount, abnormal y7Tg + MO1-amotl2a standard conditions Fig. 3 from Wang et al., 2011
posterior lateral line primordium cell population proliferation increased occurrence, abnormal zf106Tg + MO1-amotl2a standard conditions Fig. 3 with image,  Fig. 6 with image from Agarwala et al., 2015
posterior lateral line primordium posterior region has extra parts of type posterior lateral line primordium cell, abnormal zf106Tg + MO1-amotl2a standard conditions Fig. 3 with image from Agarwala et al., 2015
posterior lateral line primordium has extra parts of type posterior lateral line primordium cell, abnormal zf106Tg + MO1-amotl2a standard conditions Fig. 6 with image from Agarwala et al., 2015
posterior lateral line primordium posterior lateral line neuromast primordium migration decreased speed, abnormal zf106Tg + MO1-amotl2a standard conditions Fig. 2 with image from Agarwala et al., 2015
dorsal longitudinal anastomotic vessel closed, abnormal s843Tg; sd2Tg + MO1-amotl2a standard conditions Fig. 1 from Hultin et al., 2014
trunk vasculature blood circulation decreased occurrence, abnormal s843Tg; sd2Tg + MO1-amotl2a standard conditions Fig. 1 from Hultin et al., 2014
intersegmental vein closed, abnormal s843Tg; sd2Tg + MO1-amotl2a standard conditions Fig. 1 from Hultin et al., 2014
dorsal aorta morphogenesis decreased process quality, abnormal s843Tg; sd2Tg + MO1-amotl2a standard conditions Fig. 1 from Hultin et al., 2014
dorsal aorta blood vessel lumenization decreased process quality, abnormal s843Tg; sd2Tg + MO1-amotl2a standard conditions Fig. 1 from Hultin et al., 2014
dorsal aorta closed, abnormal s843Tg; sd2Tg + MO1-amotl2a standard conditions Fig. 1 from Hultin et al., 2014
integument actin cytoskeleton morphology, abnormal WT + MO1-amotl2a + MO1-amotl2b standard conditions Fig. 6 with image from Hildebrand et al., 2017
integument epithelial cell increased area, abnormal WT + MO1-amotl2a + MO1-amotl2b standard conditions Fig. 6 with image,  Fig. S4 with image from Hildebrand et al., 2017
pericardium edematous, abnormal WT + MO1-amotl2a + MO1-amotl2b standard conditions Fig. 6 with image from Hildebrand et al., 2017
integument filamentous actin structure, abnormal WT + MO1-amotl2a + MO1-amotl2b standard conditions Fig. S4 with image from Hildebrand et al., 2017
blood circulation disrupted, abnormal WT + MO1-amotl2a + MO1-amotl2b standard conditions Fig. 6 with image from Hildebrand et al., 2017
integument epithelial cell shape, abnormal WT + MO1-amotl2a + MO1-amotl2b standard conditions Fig. 6 with image,  Fig. S4 with image from Hildebrand et al., 2017
eye decreased size, abnormal axin1tm213/+ + MO1-amot + MO1-amotl1 + MO1-amotl2a (TU) standard conditions Fig. 2 from Li et al., 2012
eye agenesis, abnormal axin1tm213/tm213 + MO1-amot + MO1-amotl1 + MO1-amotl2a (TU) standard conditions Fig. 2 from Li et al., 2012
dorsal aorta blood vessel lumenization disrupted, abnormal y1Tg + MO1-amotl2a + MO1-amotl2b standard conditions Fig. 1 with image from Hultin et al., 2017
dorsal aorta decreased diameter, abnormal y1Tg + MO1-amotl2a + MO1-amotl2b standard conditions Fig. 1 with image from Hultin et al., 2017
dorsal aorta constricted, abnormal y1Tg + MO1-amotl2a + MO1-amotl2b + MO2-amotl2b + MO3-amotl2b standard conditions Fig. 2 from Hultin et al., 2014
dorsal aorta endothelial cell morphogenesis decreased process quality, abnormal y1Tg + MO1-amotl2a + MO1-amotl2b + MO2-amotl2b + MO3-amotl2b standard conditions Fig. 3 from Hultin et al., 2014
dorsal aorta decreased diameter, abnormal y1Tg + MO1-amotl2a + MO1-amotl2b + MO2-amotl2b + MO3-amotl2b standard conditions Fig. 2 from Hultin et al., 2014
dorsal aorta blood vessel lumenization decreased process quality, abnormal y1Tg + MO1-amotl2a + MO1-amotl2b + MO2-amotl2b + MO3-amotl2b standard conditions Fig. 2 from Hultin et al., 2014
dorsal aorta blood vessel endothelial cell decreased length, abnormal y1Tg + MO1-amotl2a + MO1-amotl2b + MO2-amotl2b + MO3-amotl2b standard conditions Fig. 3 from Hultin et al., 2014
dorsal aorta morphogenesis decreased process quality, abnormal y1Tg + MO1-amotl2a + MO1-amotl2b + MO2-amotl2b + MO3-amotl2b standard conditions Fig. 2,  Fig. 3 from Hultin et al., 2014
posterior lateral line primordium has number of posterior lateral line primordium cell, ameliorated zf106Tg + MO1-amotl2a + MO1-yap1 standard conditions Fig. 6 with image from Agarwala et al., 2015
posterior lateral line primordium cell population proliferation occurrence, ameliorated zf106Tg + MO1-amotl2a + MO1-yap1 standard conditions Fig. 6 with image from Agarwala et al., 2015
dorsal aorta blood vessel endothelial cell malformed, abnormal mu101Tg; mu271Tg + MO1-amotl2a + MO1-amotl2b + MO2-amotl2b + MO3-amotl2b standard conditions Fig. 3 from Hultin et al., 2014
blood vessel endothelial cell actin filament disorganized, abnormal mu101Tg; mu271Tg + MO1-amotl2a + MO1-amotl2b + MO2-amotl2b + MO3-amotl2b standard conditions Fig. 3 from Hultin et al., 2014
dorsal aorta morphogenesis decreased process quality, abnormal mu101Tg; mu271Tg + MO1-amotl2a + MO1-amotl2b + MO2-amotl2b + MO3-amotl2b standard conditions Fig. 3 from Hultin et al., 2014
blood vessel endothelial cell filamentous actin punctate, abnormal mu101Tg; mu271Tg + MO1-amotl2a + MO1-amotl2b + MO2-amotl2b + MO3-amotl2b standard conditions Fig. 3 from Hultin et al., 2014
intersegmental vein closed, abnormal s843Tg; sd2Tg + MO1-amotl2a + MO1-amotl2b + MO2-amotl2b + MO3-amotl2b standard conditions Fig. 1 from Hultin et al., 2014
trunk vasculature blood circulation decreased occurrence, abnormal s843Tg; sd2Tg + MO1-amotl2a + MO1-amotl2b + MO2-amotl2b + MO3-amotl2b standard conditions Fig. 1 from Hultin et al., 2014
dorsal longitudinal anastomotic vessel closed, abnormal s843Tg; sd2Tg + MO1-amotl2a + MO1-amotl2b + MO2-amotl2b + MO3-amotl2b standard conditions Fig. 1 from Hultin et al., 2014
dorsal aorta blood vessel lumenization decreased process quality, abnormal s843Tg; sd2Tg + MO1-amotl2a + MO1-amotl2b + MO2-amotl2b + MO3-amotl2b standard conditions Fig. 1 from Hultin et al., 2014
dorsal aorta closed, abnormal s843Tg; sd2Tg + MO1-amotl2a + MO1-amotl2b + MO2-amotl2b + MO3-amotl2b standard conditions Fig. 1 from Hultin et al., 2014
dorsal aorta morphogenesis decreased process quality, abnormal s843Tg; sd2Tg + MO1-amotl2a + MO1-amotl2b + MO2-amotl2b + MO3-amotl2b standard conditions Fig. 1 from Hultin et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.