header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060214-6
Morpholino Name: MO2-lef1
Target: lef1 (1)
Sequence:
5' - ACTGCCTGGATGAAACACTTACATG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice blocker
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-lef1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-lef1
Expressed Gene Anatomy Figures
ascl1a Fig. 4 with image from Lee et al., 2006
barhl2 Fig. S6 with image from Russek-Blum et al., 2008
dhrs9 Fig. 5 with image from Rai et al., 2010
dlx2a Fig. 4 with image from Lee et al., 2006
dmbx1a Fig. 3 with image from Bonkowsky et al., 2008
emx2 Fig. 3 with image from Lee et al., 2006
fabp2 Fig. 5 with image from Rai et al., 2010
foxp2 Fig. 3 with imageFig. S1 with image from Bonkowsky et al., 2008
isl1 Fig. 4 with image from Lee et al., 2006
lef1 Fig. S1 with image from Lee et al., 2006
neurog1 Fig. 4 with image from Lee et al., 2006
nkx2.4b Fig. 3 with image from Lee et al., 2006
olig2 Fig. 4 with image from Lee et al., 2006
prss1 Fig. 5 with image from Rai et al., 2010
rbp3 Fig. 5 with image from Rai et al., 2010
rx3 Fig. 3 with image from Lee et al., 2006
slc6a3 Fig. 8 with image from Russek-Blum et al., 2008
sox3 Fig. 4 with image from Lee et al., 2006
th Fig. S6 with image from Russek-Blum et al., 2008
zic2a Fig. 2 from Ota et al., 2012
Fig. 6 with image from Nyholm et al., 2007
PHENOTYPE
Phenotype resulting from MO2-lef1
Phenotype of all Fish created by or utilizing MO2-lef1
Phenotype Fish Conditions Figures
dorsal root ganglion decreased amount, abnormal WT + MO2-lef1 standard conditions Fig. 1 from Ishitani et al., 2005
brain wholly posterioralized, abnormal WT + MO2-lef1 standard conditions Fig. 6 with image from Nyholm et al., 2007
dorsal root ganglion mislocalised, abnormal WT + MO2-lef1 standard conditions Fig. 1 from Ishitani et al., 2005
neural crest cell development disrupted, abnormal WT + MO2-lef1 standard conditions Fig. 1 from Ishitani et al., 2005
cranial cartilage morphology, abnormal WT + MO2-lef1 standard conditions Fig. 1 from Ishitani et al., 2005
midbrain morphology, abnormal WT + MO2-lef1 standard conditions Fig. 6 with image from Nyholm et al., 2007
hypothalamus cell differentiation disrupted, abnormal WT + MO2-lef1 standard conditions Fig. 5 with image from Lee et al., 2006
diencephalon dopaminergic neuron increased amount, abnormal WT + MO2-lef1 standard conditions Fig. 8 with imageFig. S6 with image from Russek-Blum et al., 2008
hypothalamus neuron decreased amount, abnormal WT + MO2-lef1 standard conditions Fig. 5 with image from Lee et al., 2006
mandibular arch skeleton decreased size, abnormal WT + MO2-lef1 standard conditions Fig. 1 from Ishitani et al., 2005
hypothalamus neuron morphology, abnormal WT + MO2-lef1 standard conditions Fig. 4 with image from Lee et al., 2006
forebrain neuron development disrupted, abnormal WT + MO2-lef1 standard conditions Fig. 4 with image from Lee et al., 2006
cartilage morphogenesis disrupted, abnormal WT + MO2-lef1 standard conditions Fig. 1 from Ishitani et al., 2005
hypothalamus axon decreased amount, abnormal WT + MO2-lef1 standard conditions Fig. 5 with image from Lee et al., 2006
cell proliferation in midbrain decreased occurrence, abnormal WT + MO2-lef1 standard conditions Fig. 2 from Ota et al., 2012
midbrain development disrupted, abnormal rw0130aTg + MO2-lef1 standard conditions Fig. 2 from Ota et al., 2012
optic tectum decreased size, abnormal rw0130aTg + MO2-lef1 standard conditions Fig. 2 from Ota et al., 2012
midbrain development disrupted, abnormal rw0130aTg + MO2-lef1 + MO4-tp53 standard conditions Fig. 2 from Ota et al., 2012
optic tectum decreased size, abnormal rw0130aTg + MO2-lef1 + MO4-tp53 standard conditions Fig. 2 from Ota et al., 2012
retina development in camera-type eye disrupted, abnormal apchu745/hu745 + MO2-lef1 standard conditions Fig. 5 with image from Rai et al., 2010
retina immature, abnormal apchu745/hu745 + MO2-lef1 standard conditions Fig. 5 with image from Rai et al., 2010
OTHER MO2-lef1 MORPHOLINO PAGESNo links to external sites
CITATIONS (10)