ZFIN ID: ZDB-MRPHLNO-050301-1
Morpholino Name: MO3-neurog1
Target: neurog1 (1)
Previous Names: MO#2 (1), ngn15'UTR (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ACCTTATTGGTGGGCTGGGAGATGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-neurog1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-neurog1
Expressed Gene Anatomy Figures
neurog1 forebrain Fig. 3 with image from Jeong et al., 2006
slc6a3 (not) dopaminergic neuron Fig. 2 with image from Jeong et al., 2006
th (not) diencephalon, dopaminergic neuron, forebrain (all 6) expand Fig. 2 with image from Jeong et al., 2006
PHENOTYPE 
Phenotype resulting from MO3-neurog1
Phenotype Figures
forebrain dopaminergic neuron absent, abnormal Fig. 2 with image from Jeong et al., 2006

Phenotype of all Fish created by or utilizing MO3-neurog1
Phenotype Fish Conditions Figures
forebrain dopaminergic neuron absent, abnormal WT + MO3-neurog1 standard conditions Fig. 2 with image from Jeong et al., 2006
OTHER MO3-neurog1 MORPHOLINO PAGESNo links to external sites
CITATIONS (4)