Genomic Feature

tc300a

ID
ZDB-ALT-980203-1750
Name
tc300a
Synonyms
  • AC100A (1)
  • wirligig (1)
  • wrl (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (2)
Protocol
adult males treated with ENU
Lab of Origin
Nüsslein-Volhard Lab
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 20: 45898583 (GRCz11) (1) Details
Nucleotide change
T/G
Variant Notes
TGT->TGG
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>G (1)
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Cys>Trp (1)
Sequences
Flanking Sequence
GAGGTGTTCAGGCCAGCTTTGGCCCCCTCCAAAGAGCCTCTAACCAGACTTCTGGACACCCGTCTGGTGCAGGACTCTCACACGCGCTGGGAAAGCTTCGACGTGGGTTCAGCTGTGGCACGCTGGGCCCGCGAATCCCAGCACAACCATGGGCTCCTTGTAGAGGTGCTCCATCCTAAGGAGTCAGAAGTATCCGAGGAGGCTGAGAGCAACCGGAGGAAGCACGTGAGGGTCAGTCGTTCCCTTCACGCGGATGAGGACTCGTGGGCACAAGCCCGACCTCTGCTGGTAACCTACAGCCATGACGGTCAAGGCACAGCCGTCTTGCATTCGAACCGAGAAAAGCGGCAGGCTCGACGAGGGCAAAAGCCGAGGAGAAAGCACCACCAGCGCTCGAACTGTAGGCGACATGCTCTCTATGTGGACTTCAGTGATGTCGGCTGGAACGAGTGGATCGTGGCACCGCCAGGCTATCATGCTTTCTACTGCCATGGCGAGTG
T/G CCGTTCCCTCTGCCGGACCATCTAAACTCCACCAACCATGCCATTGTCCAGACGCTGGTGAACTCGGTCAACTCCAACATTCCCAAAGCCTGTTGCATCCCGACGGAGCTCAGCCCTATCTCACTGCTGTACCTGGACGAGTACGAGAAGGTCATTCTTAAAAACTACCAGGACATGGTGGTGGAGGGCTGCGGTTGCCGATGAGAACAATCTCCCCAATGAAGACTTTTATTTATACAAAAGAGCGAGCTATTTTGGAGGAAGAAAAGAAATATATATGAATATATTTATGTTGAATGAACAAAACAAAAAAAATGGGAAAATAAATATTTTAATGAGAGTGCTTGCTTTTTCCAGTGGCTTCGAAGATGATTTTTTTTCTTGCCCCATTCCAAAACAAGTGCAATGGCACATGAAGTATAATGCTCAGATTTTTATGATGTATTTATTGCATAACCACTTTATTTGTAAATGTGTATTTATCATGAAAAAATATATGA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
tc300a.pdf
Citations