Morpholino

MO2-dll4

ID

ZDB-MRPHLNO-070509-2

Name

MO2-dll4

Previous Names

None

Target

dll4 (1)

Sequence

5' - CGAATCTTACCTACAGGTAGATCCG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice blocking morpholino.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-dll4

Expressed Gene	Anatomy	Figures
efnb2a	dorsal aorta	Fig. 5 from Quillien et al., 2014 Fig. S6 from Siekmann et al., 2007
fli1rs	dorsal aorta intersegmental vessel posterior cardinal vein	Fig. 3 from Villefranc et al., 2013

Phenotype

Phenotype resulting from MO2-dll4

Phenotype	Fish	Figures
angiogenesis disrupted, abnormal	WT + MO2-dll4	Fig. 3 from Villefranc et al., 2013
basal communicating artery increased size, abnormal	la116Tg + MO2-dll4	Fig. 4 from Rochon et al., 2015
CiD increased amount, abnormal	nns5Tg + MO2-dll4	Fig. 3 from Okigawa et al., 2014
intersegmental artery blood vessel endothelial cell increased amount, abnormal	y7Tg + MO2-dll4	Fig. S7 from Siekmann et al., 2007
intersegmental vessel has extra parts of type endothelial cell, abnormal	WT + MO2-dll4	Fig. 3 from Villefranc et al., 2013
intersegmental vessel increased branchiness, abnormal	la116Tg + MO2-dll4	Fig. S5 from Shin et al., 2016 Fig. 3 from Villefranc et al., 2013
VeLD increased amount, abnormal	nns5Tg + MO2-dll4	Fig. 3 from Okigawa et al., 2014

Phenotype of all Fish created by or utilizing MO2-dll4

Phenotype	Fish	Conditions	Figures
intersegmental vessel has extra parts of type endothelial cell, abnormal	WT + MO2-dll4	standard conditions	Fig. 3 from Villefranc et al., 2013
intersegmental vessel increased branchiness, abnormal	WT + MO2-dll4	standard conditions	Fig. 3 from Villefranc et al., 2013
angiogenesis disrupted, abnormal	WT + MO2-dll4	standard conditions	Fig. 3 from Villefranc et al., 2013
intersegmental vessel branchiness, ameliorated	la116Tg + MO2-dll4	chemical treatment by environment: SL-327	Fig. S5 from Shin et al., 2016
basal communicating artery increased size, abnormal	la116Tg + MO2-dll4	standard conditions	Fig. 4 from Rochon et al., 2015
intersegmental vessel increased branchiness, abnormal	la116Tg + MO2-dll4	control	Fig. S5 from Shin et al., 2016
VeLD increased amount, abnormal	nns5Tg + MO2-dll4	standard conditions	Fig. 3 from Okigawa et al., 2014
CiD increased amount, abnormal	nns5Tg + MO2-dll4	standard conditions	Fig. 3 from Okigawa et al., 2014
intersegmental artery blood vessel endothelial cell increased amount, abnormal	y7Tg + MO2-dll4	standard conditions	Fig. S7 from Siekmann et al., 2007
CiD increased amount, abnormal	nns5Tg + MO2-dll4 + MO4-dla	standard conditions	Fig. 3 from Okigawa et al., 2014
VeLD increased amount, abnormal	nns5Tg + MO2-dll4 + MO4-dla	standard conditions	Fig. 3 from Okigawa et al., 2014
sprouting angiogenesis increased occurrence, abnormal	s916Tg + MO2-dll4	standard conditions	Fig. 2 from Bussmann et al., 2011
central artery increased amount, abnormal	s916Tg + MO2-dll4	standard conditions	Fig. 2 from Bussmann et al., 2011
cranial blood vessel artery morphogenesis process quality, abnormal	acvrl1^y6/y6; la116Tg + MO2-dll4	standard conditions	Fig. 4 from Rochon et al., 2015
basal communicating artery increased size, abnormal	acvrl1^y6/y6; la116Tg + MO2-dll4	standard conditions	Fig. 4 from Rochon et al., 2015
intersegmental vessel nucleus increased amount, abnormal	s916Tg; y7Tg + MO2-dll4	standard conditions	Fig. 5 from Nicoli et al., 2012
intersegmental vessel has extra parts of type endothelial cell, abnormal	vegfc^um18/+; y1Tg + MO2-dll4	standard conditions	Fig. 3 from Villefranc et al., 2013
intersegmental vessel increased branchiness, abnormal	vegfc^um18/+; y1Tg + MO2-dll4	standard conditions	Fig. 3 from Villefranc et al., 2013
angiogenesis disrupted, abnormal	vegfc^um18/um18; y1Tg/y1Tg + MO2-dll4	standard conditions	Fig. 3 from Villefranc et al., 2013
intersegmental vessel increased branchiness, abnormal	vegfc^um18/um18; y1Tg/y1Tg + MO2-dll4	standard conditions	Fig. 3 from Villefranc et al., 2013
intersegmental vessel decreased length, abnormal	s916Tg; y7Tg + MO1-dre-mir-221 + MO2-dll4	standard conditions	Fig. 5 from Nicoli et al., 2012
intersegmental vessel nucleus decreased amount, abnormal	s916Tg; y7Tg + MO1-dre-mir-221 + MO2-dll4	standard conditions	Fig. 5 from Nicoli et al., 2012

Citations