Mapping Details

Genome Browser Chr Position Assembly ZFIN JBrowse 9 1,948,465 - 1,951,144 GRCz11 Ensembl 9 1,948,465 - 1,951,144 GRCz11 Vega 9 1,947,668 - 1,950,347 GRCv10 NCBI Map Viewer 9 1,949,366 - 1,951,004 GRCz11 UCSC 9 - GRCz11

Mapped Clones containing hoxd4a
RP71-78H1	Chr: 9 Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
9	15.7 cM	hoxd4	Mother of Pearl (MOP)	Postlethwait, John H.	Data
9	109.1 cR	hoxd4a	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
9	168.0 cR	hoxd4a	Goodfellow T51 (T51)	Geisler, Robert	Data
9	0.0 cM	hoxd4a	Heat Shock (HS)	Woods, Ian G.	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS

Marker	Type	Chr	Distance	Publication / Person	Comments
evx2	GENE	9		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.
hoxd10a	GENE	9		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.
hoxd11a	GENE	9		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.
hoxd12a	GENE	9		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.
hoxd13a	GENE	9		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.
hoxd3a	GENE	9		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.
hoxd9a	GENE	9		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.
hoxd3a	GENE	9		Punnamoottil et al., 2008	Punnamoottil, et al. (2008.Dev. Dyn. 237(8): 2195-2208) mapped the proviral  ... Punnamoottil, et al. (2008.Dev. Dyn. 237(8): 2195-2208) mapped the proviral insertion Et(CLG-YFP)smb846 (CLGY846) to a position 6.5 kb downstream of hoxd4a, and 7 kb upstream of hoxd3a on LG9. The genomic sequence flanking the CLGY846 insertion (TAACCGCTGAAATTCTGT) was BLASTed against Ensembl assembly Zv7.
smb846Et	Feature	9		Punnamoottil et al., 2008	Punnamoottil, et al. (2008.Dev. Dyn. 237(8): 2195-2208) mapped the proviral  ... Punnamoottil, et al. (2008.Dev. Dyn. 237(8): 2195-2208) mapped the proviral insertion Et(CLG-YFP)smb846 (CLGY846) to a position 6.5 kb downstream of hoxd4a, and 7 kb upstream of hoxd3a on LG9. The genomic sequence flanking the CLGY846 insertion (TAACCGCTGAAATTCTGT) was BLASTed against Ensembl assembly Zv7.
hoxd9a	GENE	9		Woltering et al., 2006	Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10b-1 between hoxd4a and hoxd9a.
mir10b-1	MIRNAG	9		Woltering et al., 2006	Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10b-1 between hoxd4a and hoxd9a.

OTHER MAPPING INFORMATION

Chr 9 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2,  ... Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.   Chr 9 Woltering et al., 2006 Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10b-1 between  ... Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10b-1 between hoxd4a and hoxd9a.   Chr 9 Punnamoottil et al., 2008 Punnamoottil, et al. (2008.Dev. Dyn. 237(8): 2195-2208) mapped the proviral insertion  ... Punnamoottil, et al. (2008.Dev. Dyn. 237(8): 2195-2208) mapped the proviral insertion Et(CLG-YFP)smb846 (CLGY846) to a position 6.5 kb downstream of hoxd4a, and 7 kb upstream of hoxd3a on LG9. The genomic sequence flanking the CLGY846 insertion (TAACCGCTGAAATTCTGT) was BLASTed against Ensembl assembly Zv7.

Markers Encoded by hoxd4a
fb36c05 Chr: 9 Details

Primer Sets:

Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	469	MseI	36.0
Forward Primer	CAGGTATCTAACAAGACGGCG
Reverse Primer	CCTCGTGGTGATTTGTGAAC