| ZFIN ID: ZDB-GENE-980526-166 |
| Gene Name: | sonic hedgehog signaling molecule a |
|---|---|
| Symbol: | shha |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||
|
| Mapped Clones containing shha | |
|---|---|
| CH211-105D1 | Chr: 7 Details |
| CH211-150E22 | Chr: 7 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | DetailedSource | Citations |
|---|---|---|---|---|---|---|
| bo5Tg | 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | ||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneLinkage | |||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 7 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | |||
| hg125 | 7 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneLinkage | |||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| hg126 | 7 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneLinkage | |||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| shha_unspecified | 7 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneLinkage | |||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| tbq70 | 7 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneLinkage | |||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| tbx392 | 7 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneLinkage | |||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| tq252 | 7 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneLinkage | |||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| vcc8Gt | 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | ||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 7 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneLinkage | |||
| 7 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 7 | 111.6 cM | shh | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 7 | 165.63 cR | shh | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 7 | 4073.0 cR | shh | Goodfellow T51 (T51) | Geisler, Robert | Data |
| 7 | 86.7 cM | shh | Heat Shock (HS) | Woods, Ian G. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| en2a | GENE | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. | |
| ccne1 | GENE | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. | |
| isl2b | GENE | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. | |
| foxb1b | GENE | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. | |
| z1059 | SSLP | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. | |
| z1182 | SSLP | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. | |
| z3445 | SSLP | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. | |
| z4706 | SSLP | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. | |
| ache | GENE | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. |
|
| Markers Encoded by shha | |||
|---|---|---|---|
| fc83d08 Chr: 7 Details | |||
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 369 | MnlI | 36.0 |
| Forward Primer | ACACACACACGGAGTCGAAT | ||
| Reverse Primer | AAAGAAACAGCTCAAGACTGCA |