ZFIN ID: ZDB-GENE-980526-214

Mapping Details

Gene Name: homeobox D4a
Symbol: hoxd4a
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN JBrowse 9 1,948,465 - 1,951,144 GRCz11
Ensembl 9 1,948,465 - 1,951,144 GRCz11
Vega 9 1,947,668 - 1,950,347 GRCv10
NCBI Map Viewer 9 1,949,366 - 1,951,004 GRCz11
UCSC 9 - GRCz11
Mapped Clones containing hoxd4a
RP71-78H1 Chr: 9 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Citations
sa30912 9 1,949,742 GRCz11 Busch-Nentwich et al., 2013
9 1,948,945 GRCz10 Busch-Nentwich et al., 2013
9 1,940,541 Zv9 Busch-Nentwich et al., 2013
sa31696 9 1,950,623 GRCz11 Busch-Nentwich et al., 2013
9 1,949,826 GRCz10 Busch-Nentwich et al., 2013
9 1,941,422 Zv9 Busch-Nentwich et al., 2013
zf3363 9 1,950,495 - 1,950,500 GRCz11 Zhang et al., 2020
la016502Tg 9 1,939,632 - 1,939,642 Zv9
9 GRCz11
9 GRCz11
9 GRCz11
9 GRCz11
sa30912 9 GRCz11
9 GRCz11
9 GRCz11
9 GRCz11
sa31696 9 GRCz11
9 GRCz11
9 GRCz11
9 GRCz11
zf3363 9 GRCz11
9 GRCz11
9 GRCz11
9 GRCz11

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
9 15.7 cM hoxd4 Mother of Pearl (MOP) Postlethwait, John H. Data
9 109.1 cR hoxd4a Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
9 168.0 cR hoxd4a Goodfellow T51 (T51) Geisler, Robert Data
9 0.0 cM hoxd4a Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
evx2 GENE 9 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.
hoxd10a GENE 9 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.
hoxd11a GENE 9 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.
hoxd12a GENE 9 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.
hoxd13a GENE 9 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.
hoxd3a GENE 9 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.
hoxd9a GENE 9 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.
hoxd3a GENE 9 Punnamoottil et al., 2008 Punnamoottil, et al. (2008.Dev. Dyn. 237(8): 2195-2208) mapped the proviral  ...
smb846Et Feature 9 Punnamoottil et al., 2008 Punnamoottil, et al. (2008.Dev. Dyn. 237(8): 2195-2208) mapped the proviral  ...
hoxd9a GENE 9 Woltering et al., 2006 Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10b-1 between hoxd4a and hoxd9a.
mir10b-1 MIRNAG 9 Woltering et al., 2006 Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10b-1 between hoxd4a and hoxd9a.

OTHER MAPPING INFORMATION
Chr 9 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2,  ...
Chr 9 Woltering et al., 2006 Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10b-1 between  ...
Chr 9 Punnamoottil et al., 2008 Punnamoottil, et al. (2008.Dev. Dyn. 237(8): 2195-2208) mapped the proviral insertion  ...
Markers Encoded by hoxd4a
fb36c05 Chr: 9 Details
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 469 MseI 36.0
Forward Primer CAGGTATCTAACAAGACGGCG
Reverse Primer CCTCGTGGTGATTTGTGAAC
Genomic Feature zf3363 is an allele of hoxd4a