ZFIN ID: ZDB-GENE-980526-168

Mapping Details

Gene Name: cyclin E1
Symbol: ccne1
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 7 47,806,892 - 47,816,621 GRCz12tu
NCBI Map Viewer 7 47,806,892 - 47,816,621 GRCz12tu
Ensembl 7 46,019,780 - 46,029,879 GRCz11
NCBI Map Viewer 7 46,020,070 - 46,029,879 GRCz11
UCSC 7 - GRCz11
Vega 7 45,747,414 - 45,757,513 GRCv10
Mapped Clones containing ccne1
DKEY-56M16 Chr: 7 Details
CH211-260E23 Chr: 7 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source DetailedSource Citations
sa8454 7 47,812,751 GRCz12tu DIRECT Sealy et al., 2025
7 46,025,940 GRCz11 DIRECT Busch-Nentwich et al., 2013
7 45,753,574 GRCz10 DIRECT Busch-Nentwich et al., 2013
7 47,635,463 Zv9 DIRECT Busch-Nentwich et al., 2013
sa17090 7 47,812,310 GRCz12tu DIRECT Sealy et al., 2025
7 46,025,497 GRCz11 DIRECT Busch-Nentwich et al., 2013
7 45,753,131 GRCz10 DIRECT Busch-Nentwich et al., 2013
7 47,635,020 Zv9 DIRECT Busch-Nentwich et al., 2013
sa25369 7 47,812,597 GRCz12tu DIRECT Sealy et al., 2025
7 46,025,786 GRCz11 DIRECT Busch-Nentwich et al., 2013
7 45,753,420 GRCz10 DIRECT Busch-Nentwich et al., 2013
7 47,635,309 Zv9 DIRECT Busch-Nentwich et al., 2013
ihb541 7 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
ihb542 7 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
sa8454 7 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
sa17090 7 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
sa25369 7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
7 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
7 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
7 111.6 cM cyce Mother of Pearl (MOP) Postlethwait, John H. Data
7 176.01 cR cyce Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
7 94.5 cM ccne Heat Shock (HS) Woods, Ian G. Data
7 75.84 cM cyce Gates et al (GAT) Talbot, William S. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
z1182 SSLP 7 7.5 cM Bertrand et al., 2001 Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
isl2b GENE 7 Bertrand et al., 2001 Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
foxb1b GENE 7 Bertrand et al., 2001 Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
z1059 SSLP 7 Bertrand et al., 2001 Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
z3445 SSLP 7 Bertrand et al., 2001 Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
z4706 SSLP 7 Bertrand et al., 2001 Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
ache GENE 7 Bertrand et al., 2001 Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
en2a GENE 7 Bertrand et al., 2001 Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.
shha GENE 7 Bertrand et al., 2001 Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel.

OTHER MAPPING INFORMATION
Markers Encoded by ccne1
fa18e07 Chr: 7 Details
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 563 Tsp509I 36.0
Forward Primer AGAGAGCACCATCTCTTGACTT
Reverse Primer CAAACACTCAGAAGTTGACCAG
Genomic Feature ihb541 is an allele of ccne1