Transcript

csnk1a1-006

ID
ZDB-TSCRIPT-160112-801
Name
csnk1a1-006
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062774 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062774|OTTDARG00000043319| csnk1a1|no_translation csnk1a1-006 LG_ BX088707.15 Danio rerio protein_coding KNOWN, 734 bp
GTTCAGTGTTTAGAATCTCCAGTGGGGAAGAGGAAAAGAA
GCTTGGCTGTTAGTTCTTCTCAGGACCCATCTTTCTCAGG
ATTAAACCAGTTGTTCCTCATCGATTTTGGTCTGGCCAAG
AAATACAGAGACAACAGGACACGACAGCACATACCCTACA
GAGAAGACAAAAACCTCACAGGCACAGCTCGCTATGCCAG
CATCAACGCACACTTGGGCATCGAGCAGAGTCGTCGAGAT
GACATGGAGTCGCTAGGATATGTCCTGATGTACTTCAACA
GAACCAGCCTGCCTTGGCAGGGACTGAAGGCTGCCACAAA
GAAACAGAAATATGAGAAGATTAGTGAGAAAAAGATGTCG
ACCCCTGTTGAGGTGTTGTGTAAGGGTTTCCCAGCAGAGT
TTGCCATGTACCTGAACTACTGTCGTGGGTTGCGGTTTGA
AGAGGCGCCTGACTACATGTACCTGCGTCAGCTTTTCCGC
ATTCTTTTCAGGACTCTGAACCACCAGTATGACTACACAT
TTGACTGGACCATGCTGAAGCAGAAAGCAGCACAGCAAGC
GGCCTCCTCAGGGGGACAGGGGCAACAGGCACAAACCCCC
ACAGGCAAGCAAACTGACAAACCCAAGAGTAACATGAAAG
GTTAGTAGCAAACAGCCAAGCGACGTTTTGAGTGCAAAAA
AAAAAAAAGACAGAGACACCAATTGCTTATGTTTGTAAAA
AAAAAAAAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations