Transcript

csnk1a1-202

ID
ZDB-TSCRIPT-160112-483
Name
csnk1a1-202
Previous Names
  • csnk1a1-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062770 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062770|OTTDARG00000043319| csnk1a1|OTTDARP00000049069 csnk1a1-002 LG_ BX088707.15 Danio rerio protein_coding KNOWN, 2341 bp
AGAATCTGTTCATCCCGAGACGGACAAGATGGCGAAGTGA
GTGGGTTGCGCTTTGAAGAGAAAGCAGCGACTCACAAAAA
TTCTTCAACGTTAAAACGTCGGTTGCCTTGATGTTCGTTC
AAATAAGCGGGAAAACGCATCTTTAAGAAGAAAAATCGCC
CCTCAGAGCGAGGTGAATCGAAGAGAGCGTCGAGGACATC
GACTCCTCCGTGTCCTTTCAGGCTAAGCTGCTAGTCAGCT
ATTCGGGGAATTGCTCAAGAGAAAAAACAGCCTCAACCTC
AGGGGAAATAGTCTTGTTTTTTTTTTTTACTTAAATGTCG
AGGCAGCAAAACTTATATTGAAACCGATGTCCGTTATCAT
CTTCATTTCGTCGTTGTGAGTTAAGGACACAGCTAGTAAG
GAAGAGCCGTTTTTAGGCTAGCTAGCATTGTTTCTACTGG
ACTGAAGAAGAGAGCTGCCTGAAAACCTCGCCCGTTTACA
CAGTTTCAGTGTACTTCTCGGATTTTAGGACATGGCCAGC
AGCAGTGGCTCTAAAGCCGAGTTTATAGTCGGTGGGAAAT
ACAAGCTCGTTCGTAAAATCGGATCTGGATCCTTCGGTGA
CATTTATTTGGCAATCAACATCACAAATGGAGAGGAGGTA
GCTGTGAAATTGGAATCACAGAAAGCCAGACATCCTCAAC
TCCTATATGAAAGCAAATTGTACAAAATTCTCCAGGGAGG
AGTCGGGATCCCACACATCAGGTGGTATGGCCAAGAAAAG
GACTATAATGTCCTAGTCATGGACCTGCTCGGCCCAAGTC
TGGAAGATCTCTTTAACTTCTGTTCGCGCAGATTCACAAT
GAAAACTGTCCTAATGCTTGCAGATCAGATGATCAGCAGA
ATCGAGTATGTGCACACAAAAAACTTCATCCACAGAGATA
TCAAGCCAGACAACTTTTTAATGGGTATTGGCCGTCACTG
TAATAAGTTGTTCCTCATCGATTTTGGTCTGGCCAAGAAA
TACAGAGACAACAGGACACGACAGCACATACCCTACAGAG
AAGACAAAAACCTCACAGGCACAGCTCGCTATGCCAGCAT
CAACGCACACTTGGGCATCGAGCAGAGTCGTCGAGATGAC
ATGGAGTCGCTAGGATATGTCCTGATGTACTTCAACAGAA
CCAGCCTGCCTTGGCAGGGACTGAAGGCTGCCACAAAGAA
ACAGAAATATGAGAAGATTAGTGAGAAAAAGATGTCGACC
CCTGTTGAGGTGTTGTGTAAGGGTTTCCCAGCAGAGTTTG
CCATGTACCTGAACTACTGTCGTGGGTTGCGGTTTGAAGA
GGCGCCTGACTACATGTACCTGCGTCAGCTTTTCCGCATT
CTTTTCAGGACTCTGAACCACCAGTATGACTACACATTTG
ACTGGACCATGCTGAAGCAGAAAGCAGCACAGCAAGCGGC
CTCCTCAGGGGGACAGGGGCAACAGGCACAAACCCCCACA
GGTTTCTAAGCATTAAGACAATGTAATGAAGCAGAGCAGA
GTGGTCGTAGCAGGATTTGCCTTCCAATCACACCCCGGCA
TCTAGGATCAAATTCACCAGAACCTGCCAGGCACTGTGGG
CAACCTTTTTCCTGTTAAAGAACTTTCGTTCCATATACTA
TATATGTAATCGGTATATATAGATAAGATGCTCCGCATAT
ATCTATATATTGGTATGTATATACTATATCCACACACAGA
AGCAGGCTTGGTTTGGAGTTGGAAGCTGTAGCCTTTTCTA
TTGTCCTGTCCCTTAAGACTTTTCGCCCCCTCCTTCTTTG
AAACGGAAAACTGTAGAAAATGGGGATGTAATTGCGCACA
TGCCAATGTTTTTCCCGAGTTTTCTCCATCAGGAAATCTG
TTTGGGGTCCTTCCTGAATTCTTGGTTGCCCATCAGAGCA
GTTTTGGCCCCCTTTTCCCCCTTGTCATCGTCACAGAGTG
TGGCACGAACCCAGACACTCTTCAGAATGGAGACATCCGA
GACACATTTTCATCCTTTAATTTTTTTATTCTTCTTCCTT
TCTTCAAACAAAGTGAAACATCTGAGATTAAACCTGATTT
TGTTTTTCGTTCTTTCTTTTTCTTTTGGTTTTGTTCCAAG
TGTATCCAAATAATTAAAAAGGCAAACATTGGGTTTTGTT
CTTTTTTTCTAAAAAGGTAATTACGATTCTGCCTGCTGAT
ATGTGCTAGAGAGCTTCTAATGTGAAGATTAAAAACATTC
TAGTGACTACTAGGTTTCTCTTTAGAGCGCTGCATTAACT
ATATTGTACTTGGTATTCTGAAGTCTAAAAAAAATAAAAT
AAATAAAAGAGTAAACTCCAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations