Transcript

csnk1a1-203

ID
ZDB-TSCRIPT-160112-166
Name
csnk1a1-203
Previous Names
  • csnk1a1-004
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062772 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062772|OTTDARG00000043319| csnk1a1|OTTDARP00000049071 csnk1a1-004 LG_ BX088707.15 Danio rerio protein_coding KNOWN, 2267 bp
TTGAAGAGAAAGCAGCGACTCACAAAAATTCTTCAACGTT
AAAACGTCGGTTGCCTTGATGTTCGTTCAAATAAGCGGGA
AAACGCATCTTTAAGAAGAAAAATCGCCCCTCAGAGCGAG
GTGAATCGAAGAGAGCGTCGAGGACATCGACTCCTCCGTG
TCCTTTCAGGCTAAGCTGCTAGTCAGCTATTCGGGGAATT
GCTCAAGAGAAAAAACAGCCTCAACCTCAGGGGAAATAGT
CTTGTTTTTTTTTTTTACTTAAATGTCGAGGCAGCAAAAC
TTATATTGAAACCGATGTCCGTTATCATCTTCATTTCGTC
GTTGTGAGTTAAGGACACAGCTAGTAAGGAAGAGCCGTTT
TTAGGCTAGCTAGCATTGTTTCTACTGGACTGAAGAAGAG
AGCTGCCTGAAAACCTCGCCCGTTTACACAGTTTCAGTGT
ACTTCTCGGATTTTAGGACATGGCCAGCAGCAGTGGCTCT
AAAGCCGAGTTTATAGTCGGTGGGAAATACAAGCTCGTTC
GTAAAATCGGATCTGGATCCTTCGGTGACATTTATTTGGC
AATCAACATCACAAATGGAGAGGAGGTAGCTGTGAAATTG
GAATCACAGAAAGCCAGACATCCTCAACTCCTATATGAAA
GCAAATTGTACAAAATTCTCCAGGGAGGAGTCGGGATCCC
ACACATCAGGTGGTATGGCCAAGAAAAGGACTATAATGTC
CTAGTCATGGACCTGCTCGGCCCAAGTCTGGAAGATCTCT
TTAACTTCTGTTCGCGCAGATTCACAATGAAAACTGTCCT
AATGCTTGCAGATCAGATGATCAGCAGAATCGAGTATGTG
CACACAAAAAACTTCATCCACAGAGATATCAAGCCAGACA
ACTTTTTAATGGGTATTGGCCGTCACTGTAATAAGTGTTT
AGAATCTCCAGTGGGGAAGAGGAAAAGAAGCTTGGCTGTT
AGTTCTTCTCAGGACCCATCTTTCTCAGGATTAAACCAGT
TGTTCCTCATCGATTTTGGTCTGGCCAAGAAATACAGAGA
CAACAGGACACGACAGCACATACCCTACAGAGAAGACAAA
AACCTCACAGGCACAGCTCGCTATGCCAGCATCAACGCAC
ACTTGGGCATCGAGCAGAGTCGTCGAGATGACATGGAGTC
GCTAGGATATGTCCTGATGTACTTCAACAGAACCAGCCTG
CCTTGGCAGGGACTGAAGGCTGCCACAAAGAAACAGAAAT
ATGAGAAGATTAGTGAGAAAAAGATGTCGACCCCTGTTGA
GGTGTTGTGTAAGGGTTTCCCAGCAGAGTTTGCCATGTAC
CTGAACTACTGTCGTGGGTTGCGGTTTGAAGAGGCGCCTG
ACTACATGTACCTGCGTCAGCTTTTCCGCATTCTTTTCAG
GACTCTGAACCACCAGTATGACTACACATTTGACTGGACC
ATGCTGAAGCAGAAAGCAGCACAGCAAGCGGCCTCCTCAG
GGGGACAGGGGCAACAGGCACAAACCCCCACAGGTTTCTA
AGCATTAAGACAATGTAATGAAGCAGAGCAGAGTGGTCGT
AGCAGGATTTGCCTTCCAATCACACCCCGGCATCTAGGAT
CAAATTCACCAGAACCTGCCAGGCACTGTGGGCAACCTTT
TTCCTGTTAAAGAACTTTCGTTCCATATACTATATATGTA
ATCGGTATATATAGATAAGATGCTCCGCATATATCTATAT
ATTGGTATGTATATACTATATCCACACACAGAAGCAGGCT
TGGTTTGGAGTTGGAAGCTGTAGCCTTTTCTATTGTCCTG
TCCCTTAAGACTTTTCGCCCCCTCCTTCTTTGAAACGGAA
AACTGTAGAAAATGGGGATGTAATTGCGCACATGCCAATG
TTTTTCCCGAGTTTTCTCCATCAGGAAATCTGTTTGGGGT
CCTTCCTGAATTCTTGGTTGCCCATCAGAGCAGTTTTGGC
CCCCTTTTCCCCCTTGTCATCGTCACAGAGTGTGGCACGA
ACCCAGACACTCTTCAGAATGGAGACATCCGAGACACATT
TTCATCCTTTAATTTTTTTATTCTTCTTCCTTTCTTCAAA
CAAAGTGAAACATCTGAGATTAAACCTGATTTTGTTTTTC
GTTCTTTCTTTTTCTTTTGGTTTTGTTCCAAGTGTATCCA
AATAATTAAAAAGGCAAACATTGGGTTTTGTTCTTTTTTT
CTAAAAAGGTAATTACGATTCTGCCTGCTGATATGTGCTA
GAGAGCTTCTAATGTGAAGATTAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations