Transcript

csnk1a1-205

ID
ZDB-TSCRIPT-160112-167
Name
csnk1a1-205
Previous Names
  • csnk1a1-005
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062775 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062775|OTTDARG00000043319| csnk1a1|OTTDARP00000049072 csnk1a1-005 LG_ BX088707.15 Danio rerio protein_coding KNOWN, 876 bp
CAAATGGAGAGGAGGTAGCTGTGAAATTGGAATCACAGAA
AGCCAGACATCCTCAACTCCTATATGAAAGCAAATTGTAC
AAAATTCTCCAGGGAGGAGTCGGGATCCCACACATCAGAA
AATGGCGGATGAGAGAAAACAAGTTTCAGGGCCTAGCGAG
TCTGCTGCTGTCTTCTCAAGGTGGTATGGCCAAGAAAAGG
ACTATAATGTCCTAGTCATGGACCTGCTCGGCCCAAGTCT
GGAAGATCTCTTTAACTTCTGTTCGCGCAGATTCACAATG
AAAACTGTCCTAATGCTTGCAGATCAGATGATCAGCAGAA
TCGAGTATGTGCACACAAAAAACTTCATCCACAGAGATAT
CAAGCCAGACAACTTTTTAATGGGTATTGGCCGTCACTGT
AATAAGTTGTTCCTCATCGATTTTGGTCTGGCCAAGAAAT
ACAGAGACAACAGGACACGACAGCACATACCCTACAGAGA
AGACAAAAACCTCACAGGCACAGCTCGCTATGCCAGCATC
AACGCACACTTGGGCATCGAGCAGAGTCGTCGAGATGACA
TGGAGTCGCTAGGATATGTCCTGATGTACTTCAACAGAAC
CAGCCTGCCTTGGCAGGGACTGAAGGCTGCCACAAAGAAA
CAGAAATATGAGAAGATTAGTGAGAAAAAGATGTCGACCC
CTGTTGAGGTGTTGTGTAAGGGTTTCCCAGCAGAGTTTGC
CATGTACCTGAACTACTGTCGTGGGTTGCGGTTTGAAGAG
GCGCCTGACTACATGTACCTGCGTCAGCTTTTCCGCATTC
TTTTCAGGACTCTGAACCACCAGTATGACTACACATTTGA
CTGGACCATGCTGAAGCAGAAAGCAGCACAGCAAGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations