Transcript

csnk1a1-201

ID
ZDB-TSCRIPT-160112-800
Name
csnk1a1-201
Previous Names
  • csnk1a1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062771 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062771|OTTDARG00000043319| csnk1a1|OTTDARP00000049070 csnk1a1-001 LG_ BX088707.15 Danio rerio protein_coding KNOWN, 2471 bp
TTCAGATCAGCAGAATCTGTTCATCCCGAGACGGACAAGA
TGGCGAAGTGAGTGGGTTGCGCTTTGAAGAGAAAGCAGCG
ACTCACAAAAATTCTTCAACGTTAAAACGTCGGTTGCCTT
GATGTTCGTTCAAATAAGCGGGAAAACGCATCTTTAAGAA
GAAAAATCGCCCCTCAGAGCGAGGTGAATCGAAGAGAGCG
TCGAGGACATCGACTCCTCCGTGTCCTTTCAGGCTAAGCT
GCTAGTCAGCTATTCGGGGAATTGCTCAAGAGAAAAAACA
GCCTCAACCTCAGGGGAAATAGTCTTGTTTTTTTTTTTTA
CTTAAATGTCGAGGCAGCAAAACTTATATTGAAACCGATG
TCCGTTATCATCTTCATTTCGTCGTTGTGAGTTAAGGACA
CAGCTAGTAAGGAAGAGCCGTTTTTAGGCTAGCTAGCATT
GTTTCTACTGGACTGAAGAAGAGAGCTGCCTGAAAACCTC
GCCCGTTTACACAGTTTCAGTGTACTTCTCGGATTTTAGG
ACATGGCCAGCAGCAGTGGCTCTAAAGCCGAGTTTATAGT
CGGTGGGAAATACAAGCTCGTTCGTAAAATCGGATCTGGA
TCCTTCGGTGACATTTATTTGGCAATCAACATCACAAATG
GAGAGGAGGTAGCTGTGAAATTGGAATCACAGAAAGCCAG
ACATCCTCAACTCCTATATGAAAGCAAATTGTACAAAATT
CTCCAGGGAGGAGTCGGGATCCCACACATCAGGTGGTATG
GCCAAGAAAAGGACTATAATGTCCTAGTCATGGACCTGCT
CGGCCCAAGTCTGGAAGATCTCTTTAACTTCTGTTCGCGC
AGATTCACAATGAAAACTGTCCTAATGCTTGCAGATCAGA
TGATCAGCAGAATCGAGTATGTGCACACAAAAAACTTCAT
CCACAGAGATATCAAGCCAGACAACTTTTTAATGGGTATT
GGCCGTCACTGTAATAAGTGTTTAGAATCTCCAGTGGGGA
AGAGGAAAAGAAGCTTGGCTGTTAGTTCTTCTCAGGACCC
ATCTTTCTCAGGATTAAACCAGTTGTTCCTCATCGATTTT
GGTCTGGCCAAGAAATACAGAGACAACAGGACACGACAGC
ACATACCCTACAGAGAAGACAAAAACCTCACAGGCACAGC
TCGCTATGCCAGCATCAACGCACACTTGGGCATCGAGCAG
AGTCGTCGAGATGACATGGAGTCGCTAGGATATGTCCTGA
TGTACTTCAACAGAACCAGCCTGCCTTGGCAGGGACTGAA
GGCTGCCACAAAGAAACAGAAATATGAGAAGATTAGTGAG
AAAAAGATGTCGACCCCTGTTGAGGTGTTGTGTAAGGGTT
TCCCAGCAGAGTTTGCCATGTACCTGAACTACTGTCGTGG
GTTGCGGTTTGAAGAGGCGCCTGACTACATGTACCTGCGT
CAGCTTTTCCGCATTCTTTTCAGGACTCTGAACCACCAGT
ATGACTACACATTTGACTGGACCATGCTGAAGCAGAAAGC
AGCACAGCAAGCGGCCTCCTCAGGGGGACAGGGGCAACAG
GCACAAACCCCCACAGGCAAGCAAACTGACAAACCCAAGA
GTAACATGAAAGGTTTCTAAGCATTAAGACAATGTAATGA
AGCAGAGCAGAGTGGTCGTAGCAGGATTTGCCTTCCAATC
ACACCCCGGCATCTAGGATCAAATTCACCAGAACCTGCCA
GGCACTGTGGGCAACCTTTTTCCTGTTAAAGAACTTTCGT
TCCATATACTATATATGTAATCGGTATATATAGATAAGAT
GCTCCGCATATATCTATATATTGGTATGTATATACTATAT
CCACACACAGAAGCAGGCTTGGTTTGGAGTTGGAAGCTGT
AGCCTTTTCTATTGTCCTGTCCCTTAAGACTTTTCGCCCC
CTCCTTCTTTGAAACGGAAAACTGTAGAAAATGGGGATGT
AATTGCGCACATGCCAATGTTTTTCCCGAGTTTTCTCCAT
CAGGAAATCTGTTTGGGGTCCTTCCTGAATTCTTGGTTGC
CCATCAGAGCAGTTTTGGCCCCCTTTTCCCCCTTGTCATC
GTCACAGAGTGTGGCACGAACCCAGACACTCTTCAGAATG
GAGACATCCGAGACACATTTTCATCCTTTAATTTTTTTAT
TCTTCTTCCTTTCTTCAAACAAAGTGAAACATCTGAGATT
AAACCTGATTTTGTTTTTCGTTCTTTCTTTTTCTTTTGGT
TTTGTTCCAAGTGTATCCAAATAATTAAAAAGGCAAACAT
TGGGTTTTGTTCTTTTTTTCTAAAAAGGTAATTACGATTC
TGCCTGCTGATATGTGCTAGAGAGCTTCTAATGTGAAGAT
TAAAAACATTCTAGTGACTACTAGGTTTCTCTTTAGAGCG
CTGCATTAACTATATTGTACTTGGTATTCTGAAGTCTAAA
AAAAATAAAATAAATAAAAGAGTAAACTCCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations