header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9891
Transcript Name: actb1-006
Previous Name: bactin1-006

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027328 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027328|OTTDARG00000021466|ZDB-GENE-000329-1 actb1|no_translation bactin1-006 LG_ AL928650.5 Danio rerio protein_coding KNOWN, 856 bp
ATTGTGAGTTTTCAGTGCACGCTGAGAAGATCTTCACTCC
CCTTGTTCACAATAACCTACTAATACACAGCCATGGATGA
GGAAATCGCTGCCCTGGTCGTTGACAACGGCTCCGGTATG
TGCAAAGCCGGTTTTGCTGGAGATGATGCCCCTCGTGCTG
TTTTCCCCTCCATTGTTGGACGACCCAGACATCAGGGAGT
GATGGTTGGCATGGGACAGAAAGACTCCTATGTGGGAGAT
GAGGCCCAGAGCAAGAGAGGTATCCTGACCCTCAAATACC
CCATTGAGCACGGTATTGTGACTAACTGGGATGACATGGA
GAAGATCTGGCATCACACCTTCTACAATGAGCTCCGTGTT
GCCCCTGAGGAGCACCCTGTGCTGCTCACTGAGGCTCCCC
TGAATCCCAAAGCCAACAGAGAGAAGATGACACAGGTGTG
TTCCTGTGATCAATTTGATTTTCATATTGCCTTATTTGGC
TTTCTTCCCCTCTTTGTTCACTTCCTTTCTGTCCATTTCC
TCTTAGGCTCTGTCACTTGCCATGATCTCTTGATAGGAGG
TTCAAAAGGTTCATCCCTATTTTTTCATTCCTTTTCCCCC
TCTTGCATGGTAGCTTCTAACCTTAACTCTCCACAGTTGA
GCGTTTTAGCATGGTGTGTTGGAGGCTTTCTTGCCCTGTT
GTGCACCCATACTCACGCAGATTTGAGGCTCTGAGTTTGG
TTTTTAACCAATTATCTCTTCTACAGATCATGTTCGAGAC
CTTCAACACCCCTGCCATGTATGTGGCCATCCAGGCTGTG
CTCTCTCTGTACGCTTCTGGTCGTACTACTGGTATTGTGA
TGGACTCTGGTGATGG

actb1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA actb1-003 (1) 769
actb1-006 856
mRNA actb1-201 (1) 1788
actb1-202 (1) 1019
actb1-204 (1) 796
actb1-205 (1) 924
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
actb1-006 Contained in:
OTHER actb1-006 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000027328 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CO924331 (1) 841bp
    GenBank:CN500433 (1) 811bp
    GenBank:BI326072 (1) 505bp
    CITATIONS (1)