ZFIN ID: ZDB-TSCRIPT-090929-9889
Transcript Name: actb1-204
Previous Names: actb1-004, bactin1-004

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027326 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027326|OTTDARG00000021466|ZDB-GENE-000329-1 actb1|OTTDARP00000022382 bactin1-004 LG_ AL928650.5 Danio rerio protein_coding KNOWN, 796 bp
ATTGTGAGTTTTCAGTGCACGCTGAGAAGATCTTCACTCC
CCTTGTTCACAATAACCTACTAATACACAGTTTCGCTTTT
TTTCCCTACAGCCATGGATGAGGAAATCGCTGCCCTGGTC
GTTGACAACGGCTCCGGTATGTGCAAAGCCGGTTTTGCTG
GAGATGATGCCCCTCGTGCTGTTTTCCCCTCCATTGTTGG
ACGACCCAGACATCAGGGAGTGATGGTTGGCATGGGACAG
AAAGACTCCTATGTGGGAGATGAGGCCCAGAGCAAGAGAG
GTATCCTGACCCTCAAATACCCCATTGAGCACGGTATTGT
GACTAACTGGGATGACATGGAGAAGATCTGGCATCACACC
TTCTACAATGAGCTCCGTGTTGCCCCTGAGGAGCACCCTG
TGCTGCTCACTGAGGCTCCCCTGAATCCCAAAGCCAACAG
AGAGAAGATGACACAGATCATGTTCGAGACCTTCAACACC
CCTGCCATGTATGTGGCCATCCAGGCTGTGCTCTCTCTGT
ACGCTTCTGGTCGTACTACTGGTATTGTGATGGACTCTGG
TGATGGTGTGACCCACACCGTGCCCATCTATGAGGGTTAC
GCTCTTCCCCATGCCATCCTGCGTCTGGATCTGGCTGGTC
GTGACCTGACAGACTACCTGATGAAGATCCTGACCGAGCG
TGGCTACAGCTTCACCACCACGGCCGAAAGAGAAATTGTC
CGTGACATCAAGGAGAAGCTGTGCTACGTGGCCCTGGACT
TTGAGCAGGAGATGGGAACCGCTGCCTCCTCTTCCT

actb1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA actb1-003 (1) 769
actb1-006 (1) 856
mRNA actb1-201 (1) 1788
actb1-202 (1) 1019
actb1-204 796
actb1-205 (1) 924
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
actb1-204 Contained in:
OTHER actb1-204 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000027326 (1)
  • Ensembl_Trans:ENSDART00000138324 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DN772532 (1) 803bp
    CITATIONS (2)