Transcript

actb1-205

ID
ZDB-TSCRIPT-090929-9887
Name
actb1-205
Previous Names
  • actb1-002
  • bactin1-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027324 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027324|OTTDARG00000021466|ZDB-GENE-000329-1 actb1|OTTDARP00000029935 bactin1-002 LG_ AL928650.5 Danio rerio protein_coding KNOWN, 924 bp
GCTCAGCATTGTGAGTTTTCAGTGCACGCTGAGAAGATCT
TCACTCCCCTTGTTCACAATAACCTACTAATACACAGCCA
TGGATGAGGAAATCGCTGCCCTGGTCGTTGACAACGGCTC
CGGTATGTGCAAAGCCGGTTTTGCTGGAGATGATGCCCCT
CGTGCTGTTTTCCCCTCCATTGTTGGACGACCCAGACATC
AGGGAGTGATGGTTGGCATGGGACAGAAAGACTCCTATGT
GGGAGATGAGGCCCAGAGCAAGAGAGGTATCCTGACCCTC
AAATACCCCATTGAGCACGGTATTGTGACTAACTGGGATG
ACATGGAGAAGATCTGGCATCACACCTTCTACAATGAGCT
CCGTGTTGCCCCTGAGGAGCACCCTGTGCTGCTCACTGAG
GCTCCCCTGAATCCCAAAGCCAACAGAGAGAAGATGACAC
AGGCTCTGTCACTTGCCATGATCTCTTGATAGGAGGTTCA
AAAGATCATGTTCGAGACCTTCAACACCCCTGCCATGTAT
GTGGCCATCCAGGCTGTGCTCTCTCTGTACGCTTCTGGTC
GTACTACTGGTATTGTGATGGACTCTGGTGATGGTGTGAC
CCACACCGTGCCCATCTATGAGGGTTACGCTCTTCCCCAT
GCCATCCTGCGTCTGGATCTGGCTGGTCGTGACCTGACAG
ACTACCTGATGAAGATCCTGACCGAGCGTGGCTACAGCTT
CACCACCACGGCCGAAAGAGAAATTGTCCGTGACATCAAG
GAGAAGCTGTGCTACGTGGCCCTGGACTTTGAGCAGGAGA
TGGGAACCGCTGCCTCCTCTTCCTCCCTGGAGAAGAGCTA
TGAGCTGCCTGACGGTCAGGTCATCACCATTGGCAATGAG
CGTTTCCGTTGCCCCGAGGCTCTCTTCCAGCCTTCCTTCC
TGGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations