ZFIN ID: ZDB-TSCRIPT-090929-9887
Transcript Name: actb1-205
Previous Names: actb1-002, bactin1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027324 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027324|OTTDARG00000021466|ZDB-GENE-000329-1 actb1|OTTDARP00000029935 bactin1-002 LG_ AL928650.5 Danio rerio protein_coding KNOWN, 924 bp
GCTCAGCATTGTGAGTTTTCAGTGCACGCTGAGAAGATCT
TCACTCCCCTTGTTCACAATAACCTACTAATACACAGCCA
TGGATGAGGAAATCGCTGCCCTGGTCGTTGACAACGGCTC
CGGTATGTGCAAAGCCGGTTTTGCTGGAGATGATGCCCCT
CGTGCTGTTTTCCCCTCCATTGTTGGACGACCCAGACATC
AGGGAGTGATGGTTGGCATGGGACAGAAAGACTCCTATGT
GGGAGATGAGGCCCAGAGCAAGAGAGGTATCCTGACCCTC
AAATACCCCATTGAGCACGGTATTGTGACTAACTGGGATG
ACATGGAGAAGATCTGGCATCACACCTTCTACAATGAGCT
CCGTGTTGCCCCTGAGGAGCACCCTGTGCTGCTCACTGAG
GCTCCCCTGAATCCCAAAGCCAACAGAGAGAAGATGACAC
AGGCTCTGTCACTTGCCATGATCTCTTGATAGGAGGTTCA
AAAGATCATGTTCGAGACCTTCAACACCCCTGCCATGTAT
GTGGCCATCCAGGCTGTGCTCTCTCTGTACGCTTCTGGTC
GTACTACTGGTATTGTGATGGACTCTGGTGATGGTGTGAC
CCACACCGTGCCCATCTATGAGGGTTACGCTCTTCCCCAT
GCCATCCTGCGTCTGGATCTGGCTGGTCGTGACCTGACAG
ACTACCTGATGAAGATCCTGACCGAGCGTGGCTACAGCTT
CACCACCACGGCCGAAAGAGAAATTGTCCGTGACATCAAG
GAGAAGCTGTGCTACGTGGCCCTGGACTTTGAGCAGGAGA
TGGGAACCGCTGCCTCCTCTTCCTCCCTGGAGAAGAGCTA
TGAGCTGCCTGACGGTCAGGTCATCACCATTGGCAATGAG
CGTTTCCGTTGCCCCGAGGCTCTCTTCCAGCCTTCCTTCC
TGGG

actb1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA actb1-003 (1) 769
actb1-006 (1) 856
mRNA actb1-201 (1) 1788
actb1-202 (1) 1019
actb1-204 (1) 796
actb1-205 924
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
actb1-205 Contained in:
OTHER actb1-205 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000027324 (1)
  • Ensembl_Trans:ENSDART00000141407 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN017494 (1) 942bp
    GenBank:CK400853 (1) 857bp
    GenBank:CN322957 (1) 840bp
    GenBank:CO960485 (1) 784bp
    GenBank:BI845179 (1) 638bp
    GenBank:BM156297 (1) 500bp
    GenBank:CB363700 (1) 473bp
    CITATIONS (2)