ZFIN ID: ZDB-TSCRIPT-090929-9887
Transcript Name: actb1-205
Previous Names: actb1-002, bactin1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027324 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027324|OTTDARG00000021466|ZDB-GENE-000329-1 actb1|OTTDARP00000029935 bactin1-002 LG_ AL928650.5 Danio rerio protein_coding KNOWN, 924 bp
GCTCAGCATTGTGAGTTTTCAGTGCACGCTGAGAAGATCT
TCACTCCCCTTGTTCACAATAACCTACTAATACACAGCCA
TGGATGAGGAAATCGCTGCCCTGGTCGTTGACAACGGCTC
CGGTATGTGCAAAGCCGGTTTTGCTGGAGATGATGCCCCT
CGTGCTGTTTTCCCCTCCATTGTTGGACGACCCAGACATC
AGGGAGTGATGGTTGGCATGGGACAGAAAGACTCCTATGT
GGGAGATGAGGCCCAGAGCAAGAGAGGTATCCTGACCCTC
AAATACCCCATTGAGCACGGTATTGTGACTAACTGGGATG
ACATGGAGAAGATCTGGCATCACACCTTCTACAATGAGCT
CCGTGTTGCCCCTGAGGAGCACCCTGTGCTGCTCACTGAG
GCTCCCCTGAATCCCAAAGCCAACAGAGAGAAGATGACAC
AGGCTCTGTCACTTGCCATGATCTCTTGATAGGAGGTTCA
AAAGATCATGTTCGAGACCTTCAACACCCCTGCCATGTAT
GTGGCCATCCAGGCTGTGCTCTCTCTGTACGCTTCTGGTC
GTACTACTGGTATTGTGATGGACTCTGGTGATGGTGTGAC
CCACACCGTGCCCATCTATGAGGGTTACGCTCTTCCCCAT
GCCATCCTGCGTCTGGATCTGGCTGGTCGTGACCTGACAG
ACTACCTGATGAAGATCCTGACCGAGCGTGGCTACAGCTT
CACCACCACGGCCGAAAGAGAAATTGTCCGTGACATCAAG
GAGAAGCTGTGCTACGTGGCCCTGGACTTTGAGCAGGAGA
TGGGAACCGCTGCCTCCTCTTCCTCCCTGGAGAAGAGCTA
TGAGCTGCCTGACGGTCAGGTCATCACCATTGGCAATGAG
CGTTTCCGTTGCCCCGAGGCTCTCTTCCAGCCTTCCTTCC
TGGG

actb1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA actb1-201 (1)    Ensembl 1788
actb1-202 (1)    Ensembl 1019
actb1-204 (1)    Ensembl 796
actb1-205 924
ncRNA actb1-003 (1)    Ensembl 769
actb1-006 (1)    Ensembl 856
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
actb1-205 Contained in:
[BAC] CH211-160D14 (1)

Genome Resources: Vega_Trans:OTTDART00000027324 (1),  Ensembl_Trans:ENSDART00000141407 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CN017494 (1) 942 nt
GenBank:CK400853 (1) 857 nt
GenBank:CN322957 (1) 840 nt
GenBank:CO960485 (1) 784 nt
GenBank:BI845179 (1) 638 nt
GenBank:BM156297 (1) 500 nt
GenBank:CB363700 (1) 473 nt
CITATIONS (2)