ZFIN ID: ZDB-TSCRIPT-090929-9886
Transcript Name: actb1-201
Previous Names: actb1-001, bactin1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027323 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027323|OTTDARG00000021466|ZDB-GENE-000329-1 actb1|OTTDARP00000022381 bactin1-001 LG_ AL928650.5 Danio rerio protein_coding KNOWN, 1788 bp
CCGCTCGCTGCCGAAAGTTTACCTTATATGGAAGGAGCCG
GCCGCAGTGCCGGCTATAAAGCTGTGACCCACCTCACGCT
CAGCATTGTGAGTTTTCAGTGCACGCTGAGAAGATCTTCA
CTCCCCTTGTTCACAATAACCTACTAATACACAGCCATGG
ATGAGGAAATCGCTGCCCTGGTCGTTGACAACGGCTCCGG
TATGTGCAAAGCCGGTTTTGCTGGAGATGATGCCCCTCGT
GCTGTTTTCCCCTCCATTGTTGGACGACCCAGACATCAGG
GAGTGATGGTTGGCATGGGACAGAAAGACTCCTATGTGGG
AGATGAGGCCCAGAGCAAGAGAGGTATCCTGACCCTCAAA
TACCCCATTGAGCACGGTATTGTGACTAACTGGGATGACA
TGGAGAAGATCTGGCATCACACCTTCTACAATGAGCTCCG
TGTTGCCCCTGAGGAGCACCCTGTGCTGCTCACTGAGGCT
CCCCTGAATCCCAAAGCCAACAGAGAGAAGATGACACAGA
TCATGTTCGAGACCTTCAACACCCCTGCCATGTATGTGGC
CATCCAGGCTGTGCTCTCTCTGTACGCTTCTGGTCGTACT
ACTGGTATTGTGATGGACTCTGGTGATGGTGTGACCCACA
CCGTGCCCATCTATGAGGGTTACGCTCTTCCCCATGCCAT
CCTGCGTCTGGATCTGGCTGGTCGTGACCTGACAGACTAC
CTGATGAAGATCCTGACCGAGCGTGGCTACAGCTTCACCA
CCACGGCCGAAAGAGAAATTGTCCGTGACATCAAGGAGAA
GCTGTGCTACGTGGCCCTGGACTTTGAGCAGGAGATGGGA
ACCGCTGCCTCCTCTTCCTCCCTGGAGAAGAGCTATGAGC
TGCCTGACGGTCAGGTCATCACCATTGGCAATGAGCGTTT
CCGTTGCCCCGAGGCTCTCTTCCAGCCTTCCTTCCTGGGT
ATGGAATCTTGCGGTATCCATGAGACCACCTTCAACTCCA
TCATGAAGTGCGACGTGGACATCCGTAAGGACCTGTATGC
CAACACAGTGCTGTCTGGAGGTACCACCATGTACCCTGGC
ATTGCTGACCGTATGCAGAAGGAGATCACCTCTCTTGCTC
CTTCCACCATGAAGATCAAGATCATTGCTCCCCCTGAGCG
TAAATACTCCGTCTGGATCGGTGGCTCCATCTTGGCCTCC
CTGTCCACCTTCCAGCAGATGTGGATCAGCAAGCAGGAGT
ACGATGAGTCTGGCCCATCCATCGTCCACAGGAAGTGCTT
CTAAACAGAACTGTTGCCACCTTAAAATGGCCATGCAATG
AGATTCAAACGAACGACCAACCTAAACCTCTCGAACAAGA
TGACATCAGCATGGCTTCTGCTCTGTATGGCGCATTGACT
CAGGATGCGGAAACTGGAAAGGGAGGTAGTTGTCTAACAG
GGGGAGGAGCTTTCCCCGAGAGGACTTCAATGTACATTTC
TTTTAGTCATTCCAGAAGCGTTTACCACTTTGCCCTCCTC
ACAATGGGCGTCCATGACCTTTTTGTTATAGTGTTTATGT
AAATTATGTACTCGATACATTGTTTTTCTTTTTGTACTTC
AGCCTTAAACTTGGCCCAGTTTGTTATTGTTGCAATGAGG
GGAAAGCTTTACCTTTTAAAAAGTGAAGATCTTGCAGGAC
TTCCCTAGGGTATGTGAATAAGGGATGTCCCTTGAAAATG
TAAGCCAGGGTGTCTCTGTACACTGACAAGTCAACCCAAA
TAAAACGTGCACATGTAAAACCACACAA

actb1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA actb1-201 1788
actb1-202 (1)    Ensembl 1019
actb1-204 (1)    Ensembl 796
actb1-205 (1)    Ensembl 924
ncRNA actb1-003 (1)    Ensembl 769
actb1-006 (1)    Ensembl 856
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
actb1-201 Contained in:
[BAC] CH211-160D14 (1)

Genome Resources: Vega_Trans:OTTDART00000027323 (1),  Ensembl_Trans:ENSDART00000054987 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC045846 (1) 1726 nt
GenBank:AF057040 (1) 1700 nt
GenBank:CN177633 (1) 867 nt
GenBank:DN771621 (1) 810 nt
GenBank:CB361184 (1) 545 nt
CITATIONS (2)