ZFIN ID: ZDB-TSCRIPT-090929-9890
Transcript Name: actb1-202
Previous Names: actb1-005, bactin1-005

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027327 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027327|OTTDARG00000021466|ZDB-GENE-000329-1 actb1|OTTDARP00000022383 bactin1-005 LG_ AL928650.5 Danio rerio protein_coding KNOWN, 1019 bp
CGCCTTTGCGCCGCCTACTGGCCAGACGTCACAAATCCAT
CAGTCATCACCGCCTATAAAAGACACTACCCATTCATATT
TTAACAGTTTCGCTTTTTTTCCCTACAGCCATGGATGAGG
AAATCGCTGCCCTGGTCGTTGACAACGGCTCCGGTATGTG
CAAAGCCGGTTTTGCTGGAGATGATGCCCCTCGTGCTGTT
TTCCCCTCCATTGTTGGACGACCCAGACATCAGGGAGTGA
TGGTTGGCATGGGACAGAAAGACTCCTATGTGGGAGATGA
GGCCCAGAGCAAGAGAGGTATCCTGACCCTCAAATACCCC
ATTGAGCACGGTATTGTGACTAACTGGGATGACATGGAGA
AGATCTGGCATCACACCTTCTACAATGAGCTCCGTGTTGC
CCCTGAGGAGCACCCTGTGCTGCTCACTGAGGCTCCCCTG
AATCCCAAAGCCAACAGAGAGAAGATGACACAGATCATGT
TCGAGACCTTCAACACCCCTGCCATGTATGTGGCCATCCA
GGCTGTGCTCTCTCTGTACGCTTCTGGTCGTACTACTGGT
ATTGTGATGGACTCTGGTGATGGTGTGACCCACACCGTGC
CCATCTATGAGGGTTACGCTCTTCCCCATGCCATCCTGCG
TCTGGATCTGGCTGGTCGTGACCTGACAGACTACCTGATG
AAGATCCTGACCGAGCGTGGCTACAGCTTCACCACCACGG
CCGAAAGAGAAATTGTCCGTGACATCAAGGAGAAGCTGTG
CTACGTGGCCCTGGACTTTGAGCAGGAGATGGGAACCGCT
GCCTCCTCTTCCTCCCTGGAGAAGAGCTATGAGCTGCCTG
ACGGTCAGGTCATCACCATTGGCAATGAGCGTTTCCGTTG
CCCCGAGGCTCTCTTCCAGCCTTCCTTCCTGGGTATGGAA
TCTTGCGGTATCCATGAGACCACCTTCAACTCCATCATGA
AGTGCGACGTGGACATCCGTAAGGACCTGTATGCCAACAC
AGTGCTGTCTGGAGGTACC

actb1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA actb1-003 (1) 769
actb1-006 (1) 856
mRNA actb1-201 (1) 1788
actb1-202 1019
actb1-204 (1) 796
actb1-205 (1) 924
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
actb1-202 Contained in:
OTHER actb1-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000027327 (1)
  • Ensembl_Trans:ENSDART00000133319 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK871048 (1) 942bp
    GenBank:EG577572 (1) 914bp
    GenBank:CK864500 (1) 896bp
    GenBank:CN512911 (1) 893bp
    GenBank:CT733393 (1) 831bp
    GenBank:EB977385 (1) 657bp
    CITATIONS (2)