ZFIN ID: ZDB-TSCRIPT-090929-9888
Transcript Name: actb1-003
Previous Name: bactin1-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027325 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027325|OTTDARG00000021466|ZDB-GENE-000329-1 actb1|no_translation bactin1-003 LG_ AL928650.5 Danio rerio protein_coding KNOWN, 769 bp
GCTCAGCATTGTGAGTTTTCAGTGCACGCTGAGAAGATCT
TCACTCCCCTTGTTCACAATAACCTACTAATACACAGCCA
TGGATGAGGAAATCGCTGCCCTGGTCGTTGACAACGGCTC
CGGTATGTGCAAAGCCGGTTTTGCTGGAGATGATGCCCCT
CGTGCTGTTTTCCCCTCCATTGTTGGACGACCCAGACATC
AGGTACATTTAATAAACCATCCTAATAACATATCTGGCAT
CACACCTTCTACAATGAGCTCCGTGTTGCCCCTGAGGAGC
ACCCTGTGCTGCTCACTGAGGCTCCCCTGAATCCCAAAGC
CAACAGAGAGAAGATGACACAGATCATGTTCGAGACCTTC
AACACCCCTGCCATGTATGTGGCCATCCAGGCTGTGCTCT
CTCTGTACGCTTCTGGTCGTACTACTGGTATTGTGATGGA
CTCTGGTGATGGTGTGACCCACACCGTGCCCATCTATGAG
GGTTACGCTCTTCCCCATGCCATCCTGCGTCTGGATCTGG
CTGGTCGTGACCTGACAGACTACCTGATGAAGATCCTGAC
CGAGCGTGGCTACAGCTTCACCACCACGGCCGAAAGAGAA
ATTGTCCGTGACATCAAGGAGAAGCTGTGCTACGTGGCCC
TGGACTTTGAGCAGGAGATGGGAACCGCTGCCTCCTCTTC
CTCCCTGGAGAAGAGCTATGAGCTGCCTGACGGTCAGGTC
ATCACCATTGGCAATGAGCGTTTCCGTTGCCCCGAGGCTC
TCTTCCAGC

actb1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA actb1-201 (1)    Ensembl 1788
actb1-202 (1)    Ensembl 1019
actb1-204 (1)    Ensembl 796
actb1-205 (1)    Ensembl 924
ncRNA actb1-003 769
actb1-006 (1)    Ensembl 856
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
actb1-003 Contained in:
[BAC] CH211-160D14 (1)

Genome Resources: Vega_Trans:OTTDART00000027325 (1),  Ensembl_Trans:ENSDART00000148067 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CN838322 (1) 868 nt
CITATIONS (2)