Transcript

actb1-003

ID
ZDB-TSCRIPT-090929-9888
Name
actb1-003
Previous Names
  • bactin1-003
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027325 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027325|OTTDARG00000021466|ZDB-GENE-000329-1 actb1|no_translation bactin1-003 LG_ AL928650.5 Danio rerio protein_coding KNOWN, 769 bp
GCTCAGCATTGTGAGTTTTCAGTGCACGCTGAGAAGATCT
TCACTCCCCTTGTTCACAATAACCTACTAATACACAGCCA
TGGATGAGGAAATCGCTGCCCTGGTCGTTGACAACGGCTC
CGGTATGTGCAAAGCCGGTTTTGCTGGAGATGATGCCCCT
CGTGCTGTTTTCCCCTCCATTGTTGGACGACCCAGACATC
AGGTACATTTAATAAACCATCCTAATAACATATCTGGCAT
CACACCTTCTACAATGAGCTCCGTGTTGCCCCTGAGGAGC
ACCCTGTGCTGCTCACTGAGGCTCCCCTGAATCCCAAAGC
CAACAGAGAGAAGATGACACAGATCATGTTCGAGACCTTC
AACACCCCTGCCATGTATGTGGCCATCCAGGCTGTGCTCT
CTCTGTACGCTTCTGGTCGTACTACTGGTATTGTGATGGA
CTCTGGTGATGGTGTGACCCACACCGTGCCCATCTATGAG
GGTTACGCTCTTCCCCATGCCATCCTGCGTCTGGATCTGG
CTGGTCGTGACCTGACAGACTACCTGATGAAGATCCTGAC
CGAGCGTGGCTACAGCTTCACCACCACGGCCGAAAGAGAA
ATTGTCCGTGACATCAAGGAGAAGCTGTGCTACGTGGCCC
TGGACTTTGAGCAGGAGATGGGAACCGCTGCCTCCTCTTC
CTCCCTGGAGAAGAGCTATGAGCTGCCTGACGGTCAGGTC
ATCACCATTGGCAATGAGCGTTTCCGTTGCCCCGAGGCTC
TCTTCCAGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations