Transcript

sestd1-002

ID
ZDB-TSCRIPT-090929-9116
Name
sestd1-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026441 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026441|OTTDARG00000020954|ZDB-GENE-030801-1 sestd1|no_translation sol-002 LG_none CR848760.5,BX957295.5 Danio rerio protein_coding KNOWN, 707 bp
AAAACATTTAGATTTTCTCCCAAACTAAAAAAAGAAAGAA
AAATGCGTGACAATAATTTGGAAATTCTTACTTGCAGCCT
CGTCATATGCGTCAAAGGCATTTATAAGTGTGTTCTGTAT
TATCCAGCAGTGAGCGGTGTGTGAATATAAATGTATATTT
AGCTTCTGTCTGACGTCTCTATATCTGTGTTTGTATCAGC
TGTCTCAGCAGTTAGATGGGCTGTTGGGAATGCTCTGTGC
AGACGTCGCCCCTGCAGATGGAGCTGCAATCCAGCAAACT
CTCAAACATCTGGAGGAGAAGCTCAAGAGCGTAGAGAGTG
CCTTGCAGACCTTGAGAGAAAAAGGCCAAGCGCTGCTTGA
CCAGATGTCCAACCAGACATCTTTTTCCTACGGCAAGGAA
GTAGGGGTTGAGAACAAGGAGAATATCGACCACATTCACA
GCGTCATGGAGGACATGCAGCTCCGCAAACAGAGGTGTGA
GGATATGGTTGATGTCAGGAGACTGAAGATGCTGCAGATG
GTTCAGCTCTTCAAGTGTGAGGAAGATGCTTCACAGGCAG
TAGAGTGGTTGGGAGAGTTGCTCGATGCTTTGTTGAAGAC
CCACATCCGACTGGGAGATGATTCACAAGAAACCAAAGTG
CTGCTGGAGAAACACAAGAAGTTTGTGGATGTTGCACAGA
GCACGTATGATTACGGTCGTCAGCTGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations