Transcript

sestd1-202

ID
ZDB-TSCRIPT-090929-15416
Name
sestd1-202
Previous Names
  • sestd1-005
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000034681 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000034681|OTTDARG00000020954|ZDB-GENE-030801-1 sestd1|OTTDARP00000027931 sol-005 LG_none CR848760.5,BX957295.5 Danio rerio protein_coding KNOWN, 800 bp
AGCACATGGGCTATGCAGTTGCGTCTTTAGCAGGGCTAAC
AATCACAGCATTATCATCGGCGTCCATCTGAGCTGTGTGA
GTACAAAATAGACTCATCCAGGATGGAAGCTTCCTGTATA
TTGCCGGTGCTGAAGAAGAAGCTGGCCTTTCTGTCAGGAG
GCAAGGACAGGCGCAGTGGTTTAATCCTGACCATCCCACT
ATGCACCGAACAGACCAGCATGGAGGAGCTCAGCACCACT
CTGGACTACCTTCTTGGTATTCCCAGCGAGAAATGCAAAG
CTCGGGGTTTCACAGTCATCGTCGATGGGAGGAAGTCTCA
ATGGAATATAGTGAAGACTGTTGTTTTGATGTTACAGAAC
GTGATCCCAGCTGAAGTTTCTCTTGTGTGTGTGGTGAAAC
CTGATGAATTCTGGGACAAAAAAGTGACCCATTTCTGCTT
CTGGAAGGAGAAGGACAGGCTTGGCTTTGAGGTGATTCTG
GTGTCTGCCAACAAACTCACACGCTACATCGAGCCATGCC
AGCTTACAGATGAGTTTGGTGGGAGTCTGCTTTATGATCA
TTTGGACTGGGTGAACAAACGATTGGTTTTTGAAAAATTC
ACAAAAGAATCCACGTCTCTTTTGGATGAGCTTATCGTCA
TCAATGAAAACGAGAAGGGAAGCCAGGCAGAGAAGGACAG
GTCTTCGGAGAGCAATATTCTGCCTTCATTTGATCCTGAA
ACGGTTCTTCAAACTGGACACGAACTGCTCTCAGAGCTCC
AGCAGAGGCGTTTCAATGGTTCTGAGGGTGGAGGAGGTGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations