Transcript

ottdart00000001901

ID
ZDB-TSCRIPT-090929-23225
Name
ottdart00000001901
Previous Names
  • busm1-106a20.2-001
  • dZ106A20.2-001
  • sestd1-001
  • si:busm1-106a20.2-001
Transcript Type
mRNA
Annotation Status
fragmented
Associated With Genes
Strain
AB
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000001901 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000001901|OTTDARG00000001780|ZDB-GENE-030801-1 sestd1|OTTDARP00000001680 BUSM1-106A20.2-001 LG_ AL732415.9 Danio rerio protein_coding NOVEL, 1577 bp
ACCGCTTGAGGGTGGCAGAAGTTTCAATTATGGGAGTGGT
TTGCTGTTTACGTGGAGTTGAACCAGCAGATTGCGGCACT
GCTGAGTGCAGGAGATGAAGAGGACCTGATGGAGCTCAAG
GGTCTGCAGCAGCAGCTCAGTGACGTCTGCTACCGACAGG
CCAGCCAGTTAGAGTTCCGACAGAACGTCCTGCAGTCTGC
ATATGAGTTCCACATGACCGCACAAGATCTGTCTCAGCAG
TTAGATGGGCTGTTGGGAATGCTCTGTGCAGACGTCGCCC
CTGCAGATGGAGCTGCAATCCAGCAAACTCTCAAACATCT
GGAGGAGAAGCTCAAGAGCGTAGAGAGTGCCTTGCAGACC
TTGAGAGAAAAAGGCCAAGCGCTGCTTGACCAGATGTCCA
ACCAGACGTCTTTTTCCTACGGCAAGGAAGTAGGGATTGA
GAACAAGGAGAATATCGACCACATTCACAGCGTCATGGAG
GACATGCAGCTCCGCAAACAGAGGTGTGAGGATATGGTTG
ATGTCAGGAGACTGAAGATGCTGCAGATGGTTCAGCTCTT
CAAGTGTGAGGAAGATGCTTCACAGGCAGTAGAGTGGTTG
GGAGAGTTGCTCGATGCTTTGTTGAAGACCCACATCCGAC
TGGGAGATGATTCACAAGAAACCAAAGTGCTGCTGGAGAA
ACACAAGAAGTTTGTGGATGTTGCACAGAGCACGTATGAT
TACGGTCGTCAGCTGCTGCAGGCCACAGTGGTGCTGTGCC
AGTCTCTGCGCTGTACCACCCGCTCCTCAGGAGACACGCT
GCCCAGACTCAACCGCGTGTGGAAACAGTTCACCGTCACG
TCTGATGAGCGCCAGCACCGGCTGGAGATGGCCAGCGCCT
TTCACACGGCTGCTGAGAAGGACTTCCAGTCCCAGCAGGC
CCTGCAGTATGGCAAAGCTTCACAAGGCGCCTGGAGCAGC
TTTGGAAAGGTTGAAGGTTTAATGGAGATTCTACAGGACA
GACGCAGGCAAGTGGACCTCTGCATGAGACGACAGCAGTG
TGAGCTGGAAGCCATCCACTGCATTTGCCAATGGGAGCAA
CAGGAGCAGGAGGTAACACAAAAGTTTAAGGAAAACGCGT
TGTTCTTGGAAAACAGTAATCTGGGATTCTCTTTGTCAGA
AAACGAGAAGCTACTGCAAGAATACAAAGAAATTGAACAG
AAAGCCAAGGACTGGGCTGTTCTGGTGGAGAAGTTACTAG
AGCAGGCATCATATCTGCTTTCCTCAAATGAGTCCACACA
ACTTCAATGCTTGTCAAAGAAGAGTGAAAAACTCAGAGCA
TCACACCAGCAGTTCTGGAGCCTCATGATGAGTAGACAGG
CTCATCTGCAAGAGAGCAATACTTTTTACAGCAGCGCTAA
TAAAGCATTTGAGGCGCTGGCCACTATAGAGAGTGCTATT
AAGGAACTAAAGACTCAACCTCTGGCTTTACCTGAACTGG
CCAAGAAACATGAAGAATTTTCATGCAGAATTAAAGACGC
CTCTGCTGAGTCTCTTCAGAGAGGTCATCTGTTACTCCAG
AAGCTTGAACCACAGAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations