Transcript

sestd1-205

ID
ZDB-TSCRIPT-090929-9115
Name
sestd1-205
Previous Names
  • sestd1-001
  • sol-001
  • ottdart00000026440
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026440 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026440|OTTDARG00000020954|ZDB-GENE-030801-1 sestd1|OTTDARP00000021689 sol-001 LG_none CR848760.5,BX957295.5 Danio rerio protein_coding KNOWN, 3280 bp
GGCGCAGTATCAGCCCCTTTCTAACAAAACGCAACGCTGA
ACGTTTTCTCAGTATCAAAGACGATTATCAATAACATAGA
TCGACTCCGGAGCTCAATGCGGAGAAAGATCATGGACCAG
GAGGGAATTGCATGAGCTGGGATGTACCTGATGTGCTGCA
TCACCGTTAAAGCTGTGTGAGTACAAAATAGACTCATCCA
GGATGGAAGCTTCCTGTATATTGCCGGTGCTGAAGAAGAA
GCTGGCCTTTCTGTCAGGAGGCAAGGACAGGCGCAGTGGT
TTAATCCTGACCATCCCACTATGCACCGAACAGACCAGCA
TGGAGGAGCTCAGCACCACTCTGGACTACCTTCTTGGTAT
TCCCAGCGAGAAATGCAAAGCTCGGGGTTTCACAGTCATC
GTCGATGGGAGGAAGTCTCAATGGAATATAGTGAAGACTG
TTGTTTTGATGTTACAGAACGTGATCCCAGCTGAAGTTTC
TCTTGTGTGTGTGGTGAAACCTGATGAATTCTGGGACAAA
AAAGTGACCCATTTCTGCTTCTGGAAGGAGAAGGACAGGC
TTGGCTTTGAGGTGATTCTGGTGTCTGCCAACAAACTCAC
ACGCTACATCGAGCCATGCCAGCTTACAGATGAGTTTGGT
GGGAGTCTGCTTTATGATCATTTGGACTGGGTGAACAAAC
GATTGGTTTTTGAAAAATTCACAAAAGAATCCACGTCTCT
TTTGGATGAGCTTATCGTCATCAATGAAAACGAGAAGGGA
AGCCAGGCAGAGAAGGACAGGTCTTCGGAGAGCAATATTC
TGCCTTCATTTGATCCTGAAACGGTTCTTCAAACTGGACA
CGAACTGCTCTCAGAGCTCCAGCAGAGGCGTTTCAATGGT
TCTGAGGGTGGAGGAGGTGGAGGAACAGCCTGGTCACCCA
TGGACGATGAGCTGCTCGCTCAGCCTCAGGTGATGAAGCT
CCTGGACTCTCTGAGGGAGCAGTACACAAAGTATCAGGAA
GTCTGTCGGCAGCGCAGCAAACGCTCCCAGCTAGAGGAAA
TCCAGACCAAGGTCATGCAGGTTGTGAATTGGCTGGAGGG
TCCTGGTACAGACCAGCTCCGCACACAGTGGGGGATTGGA
GACTCCATTCGCGCCTCTCAGGCCCTGCAGCAGAAACATG
AAGAGATCGAGAGTCAACACAGTGAGTGGTTTGCTGTTTA
CGTGGAGTTGAACCAGCAGATTGCGGCACTGCTGAGTGCA
GGAGATGAAGAGGACCTGATGGAGCTCAAGGGTCTGCAGC
AGCAGCTCAGTGACGTCTGCTACCGACAGGCCAGCCAGTT
AGAGTTCCGACAGAACGTCCTGCAGTCTGCATATGAGTTC
CACATGACCGCACAAGATCTGTCTCAGCAGTTAGATGGGC
TGTTGGGAATGCTCTGTGCAGACGTCGCCCCTGCAGATGG
AGCTGCAATCCAGCAAACTCTCAAACATCTGGAGGAGAAG
CTCAAGAGCGTAGAGAGTGCCTTGCAGACCTTGAGAGAAA
AAGGCCAAGCGCTGCTTGACCAGATGTCCAACCAGACATC
TTTTTCCTACGGCAAGGAAGTAGGGGTTGAGAACAAGGAG
AATATCGACCACATTCACAGCGTCATGGAGGACATGCAGC
TCCGCAAACAGAGGTGTGAGGATATGGTTGATGTCAGGAG
ACTGAAGATGCTGCAGATGGTTCAGCTCTTCAAGTGTGAG
GAAGATGCTTCACAGGCAGTAGAGTGGTTGGGAGAGTTGC
TCGATGCTTTGTTGAAGACCCACATCCGACTGGGAGATGA
TTCACAAGAAACCAAAGTGCTGCTGGAGAAACACAAGAAG
TTTGTGGATGTTGCACAGAGCACGTATGATTACGGTCGTC
AGCTGCTGCAGGCCACAGTGGTGCTGTGCCAGTCTCTGCG
CTGTACCACCCGCTCCTCAGGAGACACGCTGCCCAGACTC
AACCGCGTGTGGAAACAGTTCACCGTCACGTCTGATGAGC
GCCAGCACCGGCTGGAGATGGCCAGCGCCTTTCACACGGC
TGCTGAGAAGATTGTGAGAGAGAGCCCAGAGTTGGCAGAG
CTCCTGGTAGATGTGGAGGCTTATGAAGAGGTGGAGACGC
TGGGGAAAGGGCTACTGGACAGGCTCACTGTGCCAGTCAT
TTTCCCTGATGGGAGCGAACAGTTTTTCGGTAGTCCGGGT
GACATGGCCTCCTCAGCTGAAAGTATTCGTGAGCGAATGA
AGCTGGTGGAGGAGAAGAGGTTCCTGCAGGAGGAAGCAGA
GCAGAGGCTGGAGGAGGAGGAGGAGGAAGAGGAGGCGGCT
CTGGAGGTGGAACCCAGGGAGAGTTGAAGACCACTTACCC
ATTATGCCCTCCTTGCAGGAAGCGGAGTCGCAGATCTTCA
CATGCTCGTCTGGTCCGGTCCAGAACTGACTTTGAAAAAC
CCACCGTCTCTGTTGTCCTCCACCTCACCAAACCATCTTA
ACTTACAGAGCGCAGTTAAAGAGACTCCACAGCCTTATGC
TGCACTAAATAGACCACACTACTATGAACTCTCGCCCTCT
TTTAAAGCTTTACCTGTCCAGTCTTTCTCCTCCCAGCGAG
GCGCCTTGAGCTTGTAATGGTGCTACTAAACCTGTAGAAT
GTACATAAAGCGGCATCTTTACCCCATCTGTACCTGGTGC
TCTAGATTTGTAGGCCTTTCCTGACCGTAAGCATTGTATT
TTCTATTGCGTTCCTTCAGTTGCTTTGTTGAGAATTACCA
AGTCTTCTCTCTTGTGCCAGTATGAATATCCATTCGCAAG
GCCTTTGCTGAAGATGGCGATGTAGAAGCAGTGTTGAAAC
AGGACTCGACGACACATCAAAAACGGTTGTAATTTTAACA
ATGAAGGTACAAAATAAGTCAAATGTGAAACGCAACGGTT
TCATCTCATGAATTGTCAGTCTATGCGTACGCTGCTTGCA
TTAGGATGCATGTCATTAATATTCATTTCATATTTATTTT
CCTTTTTTTGTACCTTGCATACCATTTAAATTGTATAATT
GCTTTTTTGCCATTTTTAAAGGCTATATTGTATTTTATGA
AAATATAAGTTGTATAAAATAAATGAAGAAACGAAATGCG
CCCACAACAGAAGAGGAGAGGCTTTCTCTTTTACTGTCAT
AAAGCCTGCAGGTTTTTACAGTTTACAGGACTTTGTTACT
GTATGTTTGCTTTGCAAAAATAATGTCCATTGCTGTACAG
GAACATTCTAGCACCCATTCAATAAACATGGGCAATATTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations