Transcript

ottdart00000001966

ID
ZDB-TSCRIPT-090929-22653
Name
ottdart00000001966
Previous Names
  • busm1-42h5.2-001
  • dZ42H5.2-001
  • sestd1-001
  • si:busm1-42h5.2-001
Transcript Type
mRNA
Annotation Status
fragmented
Associated With Genes
Strain
AB
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000001966 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000001966|OTTDARG00000001842|ZDB-GENE-030801-1 sestd1|OTTDARP00000001740 BUSM1-42H5.2-001 LG_ AL732458.5 Danio rerio protein_coding NOVEL, 1018 bp
GTTTTCTCAGTATCAAAGACGATTATCAATAACATAGATC
GACTCCGGAGCTCAATGCGGAGAAAGATCATGGACCAGGA
GGGAATTGCATGAGCTGGGATGTACCTGATGTGCTGCATC
ACCGTTAAAGCTGTGTGAGTACAAAATAGACTCATCCAGG
ATGGAAGCTTCCTGTATATTGCCGGTGCTGAAGAAGAAGC
TGGCCTTTCTGTCAGGAGGCAAGGACAGGCGCAGTGGTTT
AATCCTGACCATCCCACTATGCACCGAACAGACCAGCATG
GAGGAGCTCAGCACCACTCTGGACTACCTTCTTGGTATTC
CCAGCGAGAAATGCAAAGCTCGGGGTTTCACAGTCATCGT
CGATGGGAGGAAGTCTCAATGGAATATAGTGAAGACTGTT
GTTTTGATGTTACAGAACGTGATCCCAGCTGAAGTTTCTC
TTGTGTGTGTGGTGAAACCTGATGAATTCTGGGACAAAAA
AGTGACCCATTTCTGCTTCTGGAAGGAGAAGGACAGGCTT
GGCTTTGAGGTGATTCTGGTGTCTGCCAACAAACTCACAC
GCTACATCGAGCCATGCCAGCTTACAGATGAGTTTGGTGG
GAGTCTGCTTTATGATCATTTGGACTGGGTGAACAAACGA
TTGGTTTTTGAAAAATTCACAAAAGAATCCACGTCTCTTT
TGGATGAGCTTATCGTCATCAATGAAAACGAGAAGGGAAG
CCAGGCAGAGAAGGACAGGTCTTCGGAGAGCAATATTCTG
CCTTCATTTGATCCTGAAACGGTTCTTCAAACTGGACACG
AACTGCTCTCAGAGCTCCAGCAGAGGCGTTTCAATGGTTC
TGAGGGTGGAGGAGGTGGAGGAACAGCCTGGTCACCCATG
GACGATGAGCTGCTCGCTCAGCCTCAGGTGATGAAGCTCC
TGGACTCTCTGAGGGAGCAGTACACAAAGTATCAGGAAGT
CTGTCGGCAGCGCAGCAAACGCTCCCAGCTAGAGGAAATC
CAGACCAAGGTCATGCAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations