Morpholino

MO1-tmem184a

ID

ZDB-MRPHLNO-180215-3

Name

MO1-tmem184a

Previous Names

ATG MO (1)

Target

tmem184a (1)

Sequence

5' - CTGAGAGTAGTTTCATTCATCCTGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-tmem184a

Expressed Gene	Anatomy	Figures
tmem184a	whole organism	FIGURE 1 from Field et al., 2022

Phenotype

Phenotype resulting from MO1-tmem184a

Phenotype	Fish	Figures
dorsal longitudinal anastomotic vessel incomplete structure, abnormal	y1Tg + MO1-tmem184a	FIGURE 2 from Field et al., 2022
intersegmental vessel Ab14-cdh5 labeling decreased amount, abnormal	y1Tg + MO1-tmem184a	FIGURE 7 from Field et al., 2022
intersegmental vessel decreased amount, abnormal	y1Tg + MO1-tmem184a	FIGURE 2 , FIGURE 5 from Field et al., 2022
intersegmental vessel decreased length, abnormal	y1Tg + MO1-tmem184a	FIGURE 2 from Field et al., 2022
intersegmental vessel endothelial cell proliferation increased occurrence, abnormal	y1Tg + MO1-tmem184a	FIGURE 6 from Field et al., 2022
whole organism Ab14-cdh5 labeling decreased amount, abnormal	y1Tg + MO1-tmem184a	FIGURE 7 from Field et al., 2022
whole organism tmem184a expression decreased amount, abnormal	C32 + MO1-tmem184a	FIGURE 1 from Field et al., 2022

Phenotype of all Fish created by or utilizing MO1-tmem184a

Phenotype	Fish	Conditions	Figures
whole organism tmem184a expression decreased amount, abnormal	C32 + MO1-tmem184a	standard conditions	FIGURE 1 from Field et al., 2022
regenerating fin post-vent vasculature decreased length, abnormal	y1Tg + MO1-tmem184a	amputation: caudal fin	Fig. 4 from Farwell et al., 2017
regenerating fin vasculature development disrupted, abnormal	y1Tg + MO1-tmem184a	amputation: caudal fin	Fig. 3 , Fig. 4 from Farwell et al., 2017
whole organism Ab14-cdh5 labeling decreased amount, abnormal	y1Tg + MO1-tmem184a	standard conditions	FIGURE 7 from Field et al., 2022
intersegmental vessel decreased amount, abnormal	y1Tg + MO1-tmem184a	standard conditions	FIGURE 2 , FIGURE 5 from Field et al., 2022
regenerating fin vasculature tangled, abnormal	y1Tg + MO1-tmem184a	amputation: caudal fin	Fig. 3 from Farwell et al., 2017
intersegmental vessel Ab14-cdh5 labeling decreased amount, abnormal	y1Tg + MO1-tmem184a	standard conditions	FIGURE 7 from Field et al., 2022
intersegmental vessel decreased length, abnormal	y1Tg + MO1-tmem184a	standard conditions	FIGURE 2 from Field et al., 2022
dorsal longitudinal anastomotic vessel incomplete structure, abnormal	y1Tg + MO1-tmem184a	standard conditions	FIGURE 2 from Field et al., 2022
regenerating fin endothelial cell proliferation increased occurrence, abnormal	y1Tg + MO1-tmem184a	amputation: caudal fin	Fig. 5 from Farwell et al., 2017
regenerating fin vasculature disorganized, abnormal	y1Tg + MO1-tmem184a	amputation: caudal fin	Fig. 3 from Farwell et al., 2017
intersegmental vessel endothelial cell proliferation increased occurrence, abnormal	y1Tg + MO1-tmem184a	standard conditions	FIGURE 6 from Field et al., 2022
intersegmental vessel decreased amount, abnormal	y1Tg + MO1-tmem184a + MO2-tmem184a	standard conditions	FIGURE S1 from Field et al., 2022
intersegmental vessel decreased amount, exacerbated	y1Tg + MO1-tmem184a + MO2-kdrl	standard conditions	FIGURE 5 from Field et al., 2022

Citations