Morpholino

MO2-hapln1a

ID

ZDB-MRPHLNO-140602-6

Name

MO2-hapln1a

Previous Names

ATG MO (1)

Target

hapln1a (1)

Sequence

5' - GCCACAGAAAACAGAGCAATCATCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-hapln1a

No data available

Phenotype

Phenotype resulting from MO2-hapln1a

No data available

Phenotype of all Fish created by or utilizing MO2-hapln1a

Phenotype	Fish	Conditions	Figures
regenerating fin cell population proliferation decreased occurrence, abnormal	AB/C32 + MO2-hapln1a	amputation: caudal fin	Fig. 3 , Fig. 6 from Govindan et al., 2016
regenerating fin decreased length, abnormal	AB/C32 + MO2-hapln1a	amputation: caudal fin	Fig. 3 , Fig. 6 from Govindan et al., 2016
regenerating fin Ab1-sema3d labeling decreased amount, abnormal	AB/C32 + MO2-hapln1a	amputation: caudal fin	Fig. 8 from Govindan et al., 2016
regenerating fin lepidotrichium segment decreased length, abnormal	AB/C32 + MO2-hapln1a	amputation: caudal fin	Fig. 3 , Fig. 6 from Govindan et al., 2016
regenerating fin acanb expression decreased amount, abnormal	AB/C32 + MO2-hapln1a	amputation: caudal fin	Fig. 5 from Govindan et al., 2016
regenerating fin cell population proliferation decreased process quality, abnormal	WT + MO2-hapln1a	physical alteration: anatomical structure	Fig. 3 from Govindan et al., 2014
regenerating fin decreased length, abnormal	WT + MO2-hapln1a	physical alteration: anatomical structure	Fig. 3 from Govindan et al., 2014
regenerating fin lepidotrichium segment decreased length, abnormal	WT + MO2-hapln1a	physical alteration: anatomical structure	Fig. 3 from Govindan et al., 2014
fin regeneration decreased process quality, abnormal	WT + MO2-hapln1a	physical alteration: anatomical structure	Fig. 3 from Govindan et al., 2014
regenerating fin decreased length, abnormal	AB/C32 + MO2-hapln1a + MO5-sema3d	amputation: caudal fin	Fig. 7 from Govindan et al., 2016
regenerating fin cell population proliferation decreased occurrence, abnormal	AB/C32 + MO2-hapln1a + MO5-sema3d	amputation: caudal fin	Fig. 7 from Govindan et al., 2016
regenerating fin lepidotrichium segment decreased length, abnormal	AB/C32 + MO2-hapln1a + MO5-sema3d	amputation: caudal fin	Fig. 7 from Govindan et al., 2016
regenerating fin decreased length, abnormal	uw14Tg + MO2-hapln1a	amputation: caudal fin	Fig. 9 from Govindan et al., 2016
regenerating fin decreased length, ameliorated	uw14Tg + MO2-hapln1a	heat shock, amputation: caudal fin	Fig. 9 from Govindan et al., 2016
regenerating fin lepidotrichium segment decreased length, ameliorated	uw14Tg + MO2-hapln1a	heat shock, amputation: caudal fin	Fig. 9 from Govindan et al., 2016
regenerating fin lepidotrichium segment decreased length, abnormal	uw14Tg + MO2-hapln1a	amputation: caudal fin	Fig. 9 from Govindan et al., 2016

Citations