Morpholino

MO3-tmem88a

ID

ZDB-MRPHLNO-131101-1

Name

MO3-tmem88a

Previous Names

None

Target

tmem88a (1)

Sequence

5' - GGAAGACTCATCTTGCCGTTCATCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-tmem88a

No data available

Phenotype

Phenotype resulting from MO3-tmem88a

No data available

Phenotype of all Fish created by or utilizing MO3-tmem88a

Phenotype	Fish	Conditions	Figures
ventricular cardiac muscle cell differentiation decreased occurrence, abnormal	WT + MO3-tmem88a + MO4-tmem88a	standard conditions	Fig. 6 from Novikov et al., 2013
cardioblast cell fate specification decreased process quality, abnormal	WT + MO3-tmem88a + MO4-tmem88a	standard conditions	Fig. 7 from Novikov et al., 2013
whole organism lacks all parts of type blood, abnormal	WT + MO3-tmem88a + MO4-tmem88a	standard conditions	Fig. 4 from Novikov et al., 2013
posterior lateral plate mesoderm physical object quality, abnormal	WT + MO3-tmem88a + MO4-tmem88a	standard conditions	Fig. S8 from Novikov et al., 2013
myocardial precursor decreased amount, abnormal	WT + MO3-tmem88a + MO4-tmem88a	standard conditions	Fig. 7 from Novikov et al., 2013
atrial cardiac muscle cell differentiation decreased occurrence, abnormal	WT + MO3-tmem88a + MO4-tmem88a	standard conditions	Fig. 6 from Novikov et al., 2013
canonical Wnt signaling pathway increased process quality, abnormal	WT + MO3-tmem88a + MO4-tmem88a	standard conditions	Fig. 9 from Novikov et al., 2013
cranial cartilage decreased object quality, abnormal	WT + MO3-tmem88a + MO4-tmem88a	standard conditions	Fig. 4 from Novikov et al., 2013
heart contraction decreased frequency, abnormal	WT + MO3-tmem88a + MO4-tmem88a	standard conditions	Fig. 4 from Novikov et al., 2013
heart edematous, abnormal	WT + MO3-tmem88a + MO4-tmem88a	standard conditions	Fig. 4 from Novikov et al., 2013
trunk decreased length, abnormal	WT + MO3-tmem88a + MO4-tmem88a	standard conditions	Fig. 4 from Novikov et al., 2013
embryonic hemopoiesis decreased process quality, abnormal	WT + MO3-tmem88a + MO4-tmem88a	standard conditions	Fig. 4 from Novikov et al., 2013
atrium decreased length, abnormal	f2Tg + MO3-tmem88a + MO4-tmem88a	standard conditions	Fig. 5 from Novikov et al., 2013
cardiac ventricle decreased length, abnormal	f2Tg + MO3-tmem88a + MO4-tmem88a	standard conditions	Fig. 5 from Novikov et al., 2013
atrium has fewer parts of type cardiac muscle cell, abnormal	f2Tg + MO3-tmem88a + MO4-tmem88a	standard conditions	Fig. 5 from Novikov et al., 2013
cardiac ventricle has fewer parts of type cardiac muscle cell, abnormal	f2Tg + MO3-tmem88a + MO4-tmem88a	standard conditions	Fig. 5 from Novikov et al., 2013
heart morphology, abnormal	twu34Tg + MO3-tmem88a + MO4-tmem88a	standard conditions	Fig. 4 from Novikov et al., 2013
heart looping decreased process quality, abnormal	twu34Tg + MO3-tmem88a + MO4-tmem88a	standard conditions	Fig. 4 from Novikov et al., 2013
canonical Wnt signaling pathway increased process quality, abnormal	w25Tg + MO3-tmem88a + MO4-tmem88a	standard conditions	Fig. 9 from Novikov et al., 2013
heart morphogenesis decreased process quality, abnormal	tp53^zdf1/zdf1 + MO3-tmem88a + MO4-tmem88a	standard conditions	Fig. S7 from Novikov et al., 2013
embryonic hemopoiesis decreased process quality, abnormal	tp53^zdf1/zdf1 + MO3-tmem88a + MO4-tmem88a	standard conditions	Fig. S7 from Novikov et al., 2013
heart morphology, abnormal	tp53^zdf1/zdf1 + MO3-tmem88a + MO4-tmem88a	standard conditions	Fig. S7 from Novikov et al., 2013
heart edematous, abnormal	tp53^zdf1/zdf1 + MO3-tmem88a + MO4-tmem88a	standard conditions	Fig. S7 from Novikov et al., 2013
myocardial precursor physical object quality, abnormal	w32Tg + MO3-tmem88a + MO4-tmem88a	standard conditions	Fig. 12 from Novikov et al., 2013
cardioblast cell fate specification decreased process quality, abnormal	w32Tg + MO3-tmem88a + MO4-tmem88a	standard conditions	Fig. 12 from Novikov et al., 2013
canonical Wnt signaling pathway decreased process quality, abnormal	w32Tg + MO3-tmem88a + MO4-tmem88a	heat shock	Fig. 12 from Novikov et al., 2013
cardioblast cell fate specification decreased process quality, abnormal	w34Tg + MO3-tmem88a + MO4-tmem88a	heat shock	Fig. 11 from Novikov et al., 2013
myocardial precursor physical object quality, abnormal	w34Tg + MO3-tmem88a + MO4-tmem88a	heat shock	Fig. 11 from Novikov et al., 2013
canonical Wnt signaling pathway increased process quality, abnormal	w34Tg + MO3-tmem88a + MO4-tmem88a	standard conditions	Fig. 11 from Novikov et al., 2013
myocardial precursor physical object quality, abnormal	w34Tg + MO3-tmem88a + MO4-tmem88a	standard conditions	Fig. 11 from Novikov et al., 2013
cardioblast cell fate specification decreased process quality, abnormal	w34Tg + MO3-tmem88a + MO4-tmem88a	standard conditions	Fig. 11 from Novikov et al., 2013
canonical Wnt signaling pathway increased process quality, abnormal	w34Tg + MO3-tmem88a + MO4-tmem88a	heat shock	Fig. 11 from Novikov et al., 2013
heart has fewer parts of type cardiac muscle cell, abnormal	f2Tg; w32Tg + MO3-tmem88a + MO4-tmem88a	standard conditions	Fig. 12 from Novikov et al., 2013
heart looping decreased process quality, abnormal	f2Tg; w32Tg + MO3-tmem88a + MO4-tmem88a	heat shock	Fig. 12 from Novikov et al., 2013
heart looping decreased process quality, abnormal	f2Tg; w32Tg + MO3-tmem88a + MO4-tmem88a	standard conditions	Fig. 12 from Novikov et al., 2013
canonical Wnt signaling pathway decreased process quality, abnormal	f2Tg; w32Tg + MO3-tmem88a + MO4-tmem88a	heat shock	Fig. 12 from Novikov et al., 2013

Citations