Morpholino

MO3-phox2bb

ID

ZDB-MRPHLNO-130820-9

Name

MO3-phox2bb

Previous Names

Target

Sequence

5' - AAGTAAGCGGAGAATGTCCCACCTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-phox2bb

Expressed Gene	Anatomy	Figures
ascl1a	superior cervical ganglion	Fig. 5 from Pei et al., 2013
dbh	superior cervical ganglion	Fig. 2 , Fig. 3 , Fig. 6 from Pei et al., 2013
elavl3	(not) superior cervical ganglion	Fig. 6 from Pei et al., 2013
phox2a	superior cervical ganglion	Fig. 5 from Pei et al., 2013
phox2bb	superior cervical ganglion	Fig. 5 , Fig. 6 from Pei et al., 2013
th	(not) superior cervical ganglion	Fig. 2 , Fig. 3 , Fig. 5 , Fig. 6 from Pei et al., 2013

Phenotype

Phenotype resulting from MO3-phox2bb

Phenotype	Fish	Figures
motor neuron axon morphology, abnormal	nig2Tg + MO3-phox2bb	Fig. 7 from Mitsuzawa et al., 2021
motor neuron axonal spine increased amount, abnormal	nig2Tg + MO3-phox2bb	Fig. 7 from Mitsuzawa et al., 2021
spinal cord axon decreased length, abnormal	nig2Tg + MO3-phox2bb	Fig. 7 from Mitsuzawa et al., 2021
spinal cord axon increased thickness, abnormal	nig2Tg + MO3-phox2bb	Fig. 7 from Mitsuzawa et al., 2021
swimming behavior disrupted, abnormal	nig2Tg + MO3-phox2bb	Fig. S4 from Mitsuzawa et al., 2021
sympathetic ganglion development disrupted, abnormal	WT + MO3-phox2bb	Fig. 2 , Fig. 3 , Fig. 6 from Pei et al., 2013
thigmotaxis disrupted, abnormal	nig2Tg + MO3-phox2bb	Fig. 7 from Mitsuzawa et al., 2021

Phenotype of all Fish created by or utilizing MO3-phox2bb

Phenotype	Fish	Conditions	Figures
sympathetic ganglion development disrupted, abnormal	WT + MO3-phox2bb	standard conditions	Fig. 2 , Fig. 3 , Fig. 6 from Pei et al., 2013
spinal cord axon increased thickness, abnormal	nig2Tg + MO3-phox2bb	standard conditions	Fig. 7 from Mitsuzawa et al., 2021
motor neuron axonal spine increased amount, abnormal	nig2Tg + MO3-phox2bb	standard conditions	Fig. 7 from Mitsuzawa et al., 2021
swimming behavior disrupted, abnormal	nig2Tg + MO3-phox2bb	standard conditions	Fig. S4 from Mitsuzawa et al., 2021
motor neuron axon morphology, abnormal	nig2Tg + MO3-phox2bb	standard conditions	Fig. 7 from Mitsuzawa et al., 2021
spinal cord axon decreased length, abnormal	nig2Tg + MO3-phox2bb	standard conditions	Fig. 7 from Mitsuzawa et al., 2021
thigmotaxis disrupted, abnormal	nig2Tg + MO3-phox2bb	standard conditions	Fig. 7 from Mitsuzawa et al., 2021
sympathetic ganglion development disrupted, abnormal	WT + MO3-ascl1a + MO3-phox2bb	standard conditions	Fig. 7 from Pei et al., 2013

Citations