Morpholino

MO5-enpp2

ID
ZDB-MRPHLNO-130116-2
Name
MO5-enpp2
Previous Names
  • atx tMO (1)
Target
Sequence
5' - CTGGTGGCTCTCTTCCACACTGAAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-enpp2
No data available
Phenotype
Phenotype resulting from MO5-enpp2
Phenotype Fish Figures
blood accumulation yolk, abnormal AB + MO5-enpp2 Fig. S3 with image from Lai et al., 2012
brain hemorrhagic, abnormal AB + MO5-enpp2 Fig. S3 with image from Lai et al., 2012
calcium-mediated signaling disrupted, abnormal AB + MO5-enpp2 Fig. 6 with image from Lai et al., 2012
cilium assembly disrupted, abnormal AB + MO5-enpp2 Fig. 5 with image from Lai et al., 2012
determination of digestive tract left/right asymmetry disrupted, abnormal AB + MO5-enpp2 Fig. S4 with image from Lai et al., 2012
determination of heart left/right asymmetry disrupted, abnormal AB + MO5-enpp2 Fig. 2 with imageFig. 7 with image from Lai et al., 2012
determination of left/right asymmetry in diencephalon disrupted, abnormal AB + MO5-enpp2 Fig. 2 with image from Lai et al., 2012
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal AB + MO5-enpp2 Fig. 2 with image from Lai et al., 2012
determination of left/right symmetry disrupted, abnormal AB + MO5-enpp2 Fig. 2 with image from Lai et al., 2012
eye hemorrhagic, abnormal AB + MO5-enpp2 Fig. S3 with image from Lai et al., 2012
forerunner cell group distributed, abnormal AB + MO5-enpp2 Fig. 4 with image from Lai et al., 2012
gut orientation whole organism left-right axis, abnormal AB + MO5-enpp2 Fig. S4 with image from Lai et al., 2012
heart jogging disrupted, abnormal AB + MO5-enpp2 Fig. 1 with imageFig. 7 with image from Lai et al., 2012
heart looping disrupted, abnormal AB + MO5-enpp2 Fig. 1 with imageFig. 7 with image from Lai et al., 2012
Kupffer's vesicle decreased size, abnormal s903Tg + MO5-enpp2 Fig. 3 with image from Lai et al., 2012
Kupffer's vesicle deformed, abnormal s903Tg + MO5-enpp2 Fig. 3 with image from Lai et al., 2012
Kupffer's vesicle morphology, abnormal AB + MO5-enpp2 Fig. 5 with image from Lai et al., 2012
Kupffer's vesicle cell mislocalised, abnormal s903Tg + MO5-enpp2 Fig. 3 with image from Lai et al., 2012
Kupffer's vesicle cilium decreased amount, abnormal AB + MO5-enpp2 Fig. 5 with image from Lai et al., 2012
Kupffer's vesicle cilium decreased volume, abnormal AB + MO5-enpp2 Fig. 5 with image from Lai et al., 2012
nucleate erythrocyte decreased amount, abnormal AB + MO5-enpp2 Fig. S3 with image from Lai et al., 2012
nucleate erythrocyte mislocalised, abnormal AB + MO5-enpp2 Fig. S3 with image from Lai et al., 2012
pericardium edematous, abnormal AB + MO5-enpp2 Fig. S3 with image from Lai et al., 2012
Phenotype of all Fish created by or utilizing MO5-enpp2
Phenotype Fish Conditions Figures
eye hemorrhagic, abnormal AB + MO5-enpp2 standard conditions Fig. S3 with image from Lai et al., 2012
determination of heart left/right asymmetry disrupted, abnormal AB + MO5-enpp2 standard conditions Fig. 2 with imageFig. 7 with image from Lai et al., 2012
Kupffer's vesicle cilium decreased volume, abnormal AB + MO5-enpp2 standard conditions Fig. 5 with image from Lai et al., 2012
gut orientation whole organism left-right axis, abnormal AB + MO5-enpp2 standard conditions Fig. S4 with image from Lai et al., 2012
forerunner cell group distributed, abnormal AB + MO5-enpp2 standard conditions Fig. 4 with image from Lai et al., 2012
nucleate erythrocyte mislocalised, abnormal AB + MO5-enpp2 standard conditions Fig. S3 with image from Lai et al., 2012
determination of left/right asymmetry in diencephalon disrupted, abnormal AB + MO5-enpp2 standard conditions Fig. 2 with image from Lai et al., 2012
heart jogging disrupted, abnormal AB + MO5-enpp2 standard conditions Fig. 1 with imageFig. 7 with image from Lai et al., 2012
nucleate erythrocyte decreased amount, abnormal AB + MO5-enpp2 standard conditions Fig. S3 with image from Lai et al., 2012
blood accumulation yolk, abnormal AB + MO5-enpp2 standard conditions Fig. S3 with image from Lai et al., 2012
calcium-mediated signaling disrupted, abnormal AB + MO5-enpp2 standard conditions Fig. 6 with image from Lai et al., 2012
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal AB + MO5-enpp2 standard conditions Fig. 2 with image from Lai et al., 2012
determination of left/right symmetry disrupted, abnormal AB + MO5-enpp2 standard conditions Fig. 2 with image from Lai et al., 2012
Kupffer's vesicle cilium decreased amount, abnormal AB + MO5-enpp2 standard conditions Fig. 5 with image from Lai et al., 2012
heart looping disrupted, abnormal AB + MO5-enpp2 standard conditions Fig. 1 with imageFig. 7 with image from Lai et al., 2012
pericardium edematous, abnormal AB + MO5-enpp2 standard conditions Fig. S3 with image from Lai et al., 2012
cilium assembly disrupted, abnormal AB + MO5-enpp2 standard conditions Fig. 5 with image from Lai et al., 2012
Kupffer's vesicle morphology, abnormal AB + MO5-enpp2 standard conditions Fig. 5 with image from Lai et al., 2012
determination of digestive tract left/right asymmetry disrupted, abnormal AB + MO5-enpp2 standard conditions Fig. S4 with image from Lai et al., 2012
brain hemorrhagic, abnormal AB + MO5-enpp2 standard conditions Fig. S3 with image from Lai et al., 2012
Kupffer's vesicle deformed, abnormal s870Tg + MO5-enpp2 standard conditions Fig. 3 with image from Lai et al., 2012
forerunner cell group distributed, abnormal s870Tg + MO5-enpp2 standard conditions Fig. 4 with image from Lai et al., 2012
Kupffer's vesicle cell mislocalised, abnormal s903Tg + MO5-enpp2 standard conditions Fig. 3 with image from Lai et al., 2012
Kupffer's vesicle deformed, abnormal s903Tg + MO5-enpp2 standard conditions Fig. 3 with image from Lai et al., 2012
Kupffer's vesicle decreased size, abnormal s903Tg + MO5-enpp2 standard conditions Fig. 3 with image from Lai et al., 2012
blood accumulation yolk, abnormal AB + MO2-lpar3 + MO5-enpp2 standard conditions Fig. S3 with image from Lai et al., 2012
Citations