Morpholino

MO1-nanog

ID
ZDB-MRPHLNO-120403-3
Name
MO1-nanog
Previous Names
  • MO1-zgc:193933
  • nanog-like-MO1 (1)
Target
Sequence
5' - CTGGCATCTTCCAGTCCGCCATTTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nanog
Expressed Gene Anatomy Figures
camsap2a Fig. 3 with imageFig. 7 with image from Xu et al., 2012
chrd Fig 2 with image from He et al., 2020
ddx4 Fig. 6Fig. 7 with image from Liu et al., 2017
Fig. 6 with image from Wang et al., 2016
dharma Fig 2 with image from He et al., 2020
dkk1b Fig 3 with image from He et al., 2020
emx1 Fig 2 with imageFig 3 with image from He et al., 2020
foxi1 Fig 2 with image from He et al., 2020
frzb Fig 3 with image from He et al., 2020
gata5 Fig. 2 with imageFig. 7 with image from Xu et al., 2012
gata6 Fig. 3 with imageFig. 7 with image from Xu et al., 2012
hnf4a Fig. 3 with imageFig. 7 with image from Xu et al., 2012
mixl1 Fig. 2 with imageFig. 7 with image from Xu et al., 2012
mxtx2 Fig. 3 with image from Xu et al., 2012
nanog Fig 2 with image from He et al., 2020
ndr1 Fig. 2 with imageFig. 7 with image from Xu et al., 2012
ndr2 Fig. 2 with imageFig. 7 with image from Xu et al., 2012
nlk1 Fig. 5 from Liu et al., 2017
otx2b Fig 2 with image from He et al., 2020
six3b Fig 2 with imageFig 3 with image from He et al., 2020
slc26a1 Fig. 3 with imageFig. 7 with image from Xu et al., 2012
sox17 Fig. 2 with image from Xu et al., 2012
sox32 Fig. 2 with imageFig. 7 with image from Xu et al., 2012
sp5l Fig 3 with image from He et al., 2020
Phenotype
Phenotype resulting from MO1-nanog
Phenotype Fish Figures
blastomere displaced to blastoderm dorsal region, abnormal TU + MO1-nanog Fig. 1 with image from Xu et al., 2012
canonical Wnt signaling pathway increased efficacy, abnormal WT + MO1-nanog Fig 3 with image from He et al., 2020
chromatin organization process quality, abnormal TU + MO1-nanog Fig. 4 from Liu et al., 2018
ectoderm dorsal region otx2b expression increased distribution, abnormal WT + MO1-nanog Fig 2 with image from He et al., 2020
ectoderm ventral region foxi1 expression decreased distribution, abnormal WT + MO1-nanog Fig 2 with image from He et al., 2020
forebrain morphology, abnormal WT + MO1-nanog Fig 2 with image from He et al., 2020
forebrain neural keel six3b expression decreased amount, abnormal WT + MO1-nanog Fig 2 with image from He et al., 2020
gastrulation disrupted, abnormal TU + MO1-nanog Fig. 1 with image from Xu et al., 2012
margin constricted, abnormal TU + MO1-nanog Fig. 1 with image from Xu et al., 2012
negative regulation of canonical Wnt signaling pathway decreased occurrence, abnormal WT + MO1-nanog Fig 3 with image from He et al., 2020
presumptive telencephalon emx1 expression decreased amount, abnormal WT + MO1-nanog Fig 2 with image from He et al., 2020
primordial germ cell increased amount, abnormal AB + MO1-nanog Fig. 6 with image from Wang et al., 2016
primordial germ cell mislocalised, abnormal AB + MO1-nanog Fig. 6 with image from Wang et al., 2016
telencephalon morphology, abnormal WT + MO1-nanog Fig 3 with image from He et al., 2020
whole organism six3b expression decreased amount, abnormal WT + MO1-nanog Fig 3 with image from He et al., 2020
whole organism emx1 expression decreased amount, abnormal WT + MO1-nanog Fig 3 with image from He et al., 2020
whole organism nanog expression decreased amount, abnormal WT + MO1-nanog Fig 2 with image from He et al., 2020
whole organism nlk1 expression decreased amount, abnormal WT + MO1-nanog Fig. 5 from Liu et al., 2017
whole organism frzb expression decreased amount, abnormal WT + MO1-nanog Fig 3 with image from He et al., 2020
whole organism dkk1b expression decreased amount, abnormal WT + MO1-nanog Fig 3 with image from He et al., 2020
whole organism dorsalized, abnormal WT + MO1-nanog Fig 2 with image from He et al., 2020
whole organism chrd expression increased amount, abnormal WT + MO1-nanog Fig 2 with image from He et al., 2020
whole organism dharma expression increased amount, abnormal WT + MO1-nanog Fig 2 with image from He et al., 2020
whole organism ddx4 expression increased amount, abnormal AB + MO1-nanog Fig. 6 from Liu et al., 2017
Fig. 6 with image from Wang et al., 2016
whole organism sp5l expression increased distribution, abnormal WT + MO1-nanog Fig 3 with image from He et al., 2020
whole organism dharma expression increased distribution, abnormal WT + MO1-nanog Fig 2 with image from He et al., 2020
whole organism chrd expression increased distribution, abnormal WT + MO1-nanog Fig 2 with image from He et al., 2020
whole organism lacks parts or has fewer parts of type presumptive endoderm, abnormal TU + MO1-nanog Fig. 2 with image from Xu et al., 2012
whole organism cell ddx4 expression increased distribution, abnormal WT + MO1-nanog Fig. 7 with image from Liu et al., 2017
yolk broken, abnormal TU + MO1-nanog Fig. 1 with image from Xu et al., 2012
yolk syncytial layer morphology, abnormal TU + MO1-nanog Fig. 3 with image from Xu et al., 2012
yolk syncytial layer nucleus decreased amount, abnormal TU + MO1-nanog Fig. 3 with image from Xu et al., 2012
Phenotype of all Fish created by or utilizing MO1-nanog
Phenotype Fish Conditions Figures
primordial germ cell increased amount, abnormal AB + MO1-nanog standard conditions Fig. 6 with image from Wang et al., 2016
whole organism ddx4 expression increased amount, abnormal AB + MO1-nanog standard conditions Fig. 6 with image from Wang et al., 2016
primordial germ cell mislocalised, abnormal AB + MO1-nanog standard conditions Fig. 6 with image from Wang et al., 2016
gastrulation disrupted, abnormal TU + MO1-nanog standard conditions Fig. 1 with image from Xu et al., 2012
yolk syncytial layer morphology, abnormal TU + MO1-nanog standard conditions Fig. 3 with image from Xu et al., 2012
chromatin organization process quality, abnormal TU + MO1-nanog standard conditions Fig. 4 from Liu et al., 2018
margin constricted, abnormal TU + MO1-nanog standard conditions Fig. 1 with image from Xu et al., 2012
whole organism lacks parts or has fewer parts of type presumptive endoderm, abnormal TU + MO1-nanog standard conditions Fig. 2 with image from Xu et al., 2012
yolk syncytial layer nucleus decreased amount, abnormal TU + MO1-nanog standard conditions Fig. 3 with image from Xu et al., 2012
yolk broken, abnormal TU + MO1-nanog standard conditions Fig. 1 with image from Xu et al., 2012
blastomere displaced to blastoderm dorsal region, abnormal TU + MO1-nanog standard conditions Fig. 1 with image from Xu et al., 2012
whole organism six3b expression decreased amount, abnormal WT + MO1-nanog standard conditions Fig 3 with image from He et al., 2020
ectoderm ventral region foxi1 expression decreased distribution, abnormal WT + MO1-nanog standard conditions Fig 2 with image from He et al., 2020
forebrain morphology, abnormal WT + MO1-nanog standard conditions Fig 2 with image from He et al., 2020
forebrain neural keel six3b expression decreased amount, abnormal WT + MO1-nanog standard conditions Fig 2 with image from He et al., 2020
whole organism dorsalized, abnormal WT + MO1-nanog standard conditions Fig 2 with image from He et al., 2020
whole organism chrd expression increased amount, abnormal WT + MO1-nanog standard conditions Fig 2 with image from He et al., 2020
whole organism dharma expression increased distribution, abnormal WT + MO1-nanog standard conditions Fig 2 with image from He et al., 2020
presumptive telencephalon emx1 expression decreased amount, abnormal WT + MO1-nanog standard conditions Fig 2 with image from He et al., 2020
whole organism chrd expression increased distribution, abnormal WT + MO1-nanog standard conditions Fig 2 with image from He et al., 2020
whole organism nlk1 expression decreased amount, abnormal WT + MO1-nanog standard conditions Fig. 5 from Liu et al., 2017
whole organism cell ddx4 expression increased distribution, abnormal WT + MO1-nanog standard conditions Fig. 7 with image from Liu et al., 2017
whole organism dharma expression increased amount, abnormal WT + MO1-nanog standard conditions Fig 2 with image from He et al., 2020
canonical Wnt signaling pathway increased efficacy, abnormal WT + MO1-nanog standard conditions Fig 3 with image from He et al., 2020
whole organism emx1 expression decreased amount, abnormal WT + MO1-nanog standard conditions Fig 3 with image from He et al., 2020
negative regulation of canonical Wnt signaling pathway decreased occurrence, abnormal WT + MO1-nanog standard conditions Fig 3 with image from He et al., 2020
whole organism dkk1b expression decreased amount, abnormal WT + MO1-nanog standard conditions Fig 3 with image from He et al., 2020
whole organism nanog expression decreased amount, abnormal WT + MO1-nanog standard conditions Fig 2 with image from He et al., 2020
ectoderm dorsal region otx2b expression increased distribution, abnormal WT + MO1-nanog standard conditions Fig 2 with image from He et al., 2020
whole organism ddx4 expression increased amount, abnormal WT + MO1-nanog standard conditions Fig. 6 from Liu et al., 2017
telencephalon morphology, abnormal WT + MO1-nanog standard conditions Fig 3 with image from He et al., 2020
whole organism frzb expression decreased amount, abnormal WT + MO1-nanog standard conditions Fig 3 with image from He et al., 2020
whole organism sp5l expression increased distribution, abnormal WT + MO1-nanog standard conditions Fig 3 with image from He et al., 2020
head absent, abnormal WT + MO1-nanog + MO1-tcf7l1a standard conditions Fig 3 with image from He et al., 2020
whole organism frzb expression amount, ameliorated WT + MO1-nanog + MO1-wnt8a + MO2-wnt8a standard conditions Fig 3 with image from He et al., 2020
whole organism emx1 expression amount, ameliorated WT + MO1-nanog + MO1-wnt8a + MO2-wnt8a standard conditions Fig 3 with image from He et al., 2020
whole organism dkk1b expression amount, ameliorated WT + MO1-nanog + MO1-wnt8a + MO2-wnt8a standard conditions Fig 3 with image from He et al., 2020
whole organism six3b expression increased amount, abnormal WT + MO1-nanog + MO1-wnt8a + MO2-wnt8a standard conditions Fig 3 with image from He et al., 2020
whole organism sp5l expression position, ameliorated WT + MO1-nanog + MO1-wnt8a + MO2-wnt8a standard conditions Fig 3 with image from He et al., 2020
Citations