Morpholino

MO2-grhl2b

ID
ZDB-MRPHLNO-120207-2
Name
MO2-grhl2b
Previous Names
  • ATG-blocking MO (1)
Target
Sequence
5' - TCTTACTGTCTGTCTCCTGTGACAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-grhl2b
No data available
Phenotype
Phenotype resulting from MO2-grhl2b
Phenotype of all Fish created by or utilizing MO2-grhl2b
Phenotype Fish Conditions Figures
brain apoptotic, abnormal WT + MO2-grhl2b standard conditions Fig. 2 with imageFig. 3 with image from Dworkin et al., 2012
midbrain hindbrain boundary absent, abnormal WT + MO2-grhl2b standard conditions Fig. 1 with imageFig. S2 with image from Dworkin et al., 2012
otolith absent, abnormal WT + MO2-grhl2b standard conditions Fig. S2 with imageFig. S3 with image from Dworkin et al., 2012
ventricular system morphology, abnormal WT + MO2-grhl2b standard conditions Fig. 1 with imageFig. S2 with image from Dworkin et al., 2012
midbrain apoptotic, abnormal WT + MO2-grhl2b standard conditions Fig. S2 with image from Dworkin et al., 2012
midbrain-hindbrain boundary morphogenesis disrupted, abnormal WT + MO2-grhl2b standard conditions Fig. 1 with imageFig. 2 with imageFig. 3 with imageFig. S2 with image from Dworkin et al., 2012
ventricular system development disrupted, abnormal WT + MO2-grhl2b standard conditions Fig. 1 with imageFig. S2 with image from Dworkin et al., 2012
midbrain hindbrain boundary morphology, abnormal WT + MO2-grhl2b standard conditions Fig. 2 with imageFig. 3 with image from Dworkin et al., 2012
hindbrain apoptotic, abnormal WT + MO2-grhl2b standard conditions Fig. 1 with imageFig. S2 with image from Dworkin et al., 2012
brain apoptotic, abnormal tp53zdf1/zdf1 + MO2-grhl2b standard conditions Fig. 2 with image from Dworkin et al., 2012
midbrain-hindbrain boundary morphogenesis disrupted, abnormal tp53zdf1/zdf1 + MO2-grhl2b standard conditions Fig. 2 with image from Dworkin et al., 2012
midbrain hindbrain boundary morphology, abnormal tp53zdf1/zdf1 + MO2-grhl2b standard conditions Fig. 2 with image from Dworkin et al., 2012
midbrain hindbrain boundary neural tube morphology, exacerbated TU + MO2-grhl2b + MO2-grhl3 standard conditions Fig. 4 with image from Miles et al., 2017
somite shape, abnormal TU + MO2-grhl2b + MO2-grhl3 standard conditions Fig. 4 with image from Miles et al., 2017
post-vent region agenesis, abnormal TU + MO2-grhl2b + MO2-grhl3 standard conditions Fig. 4 with image from Miles et al., 2017
notochord increased width, abnormal TU + MO2-grhl2b + MO2-grhl3 standard conditions Fig. 4 with image from Miles et al., 2017
convergent extension involved in axis elongation disrupted, abnormal TU + MO2-grhl2b + MO2-grhl3 standard conditions Fig. 4 with image from Miles et al., 2017
midbrain-hindbrain boundary morphogenesis disrupted, abnormal TU + MO2-grhl2b + MO2-grhl3 standard conditions Fig. 4 with image from Miles et al., 2017
whole organism anterior-posterior axis decreased length, exacerbated TU + MO2-grhl2b + MO2-grhl3 standard conditions Fig. 4 with image from Miles et al., 2017
brain apoptotic, abnormal WT + MO1-en2a + MO2-grhl2b standard conditions Fig. 3 with image from Dworkin et al., 2012
midbrain-hindbrain boundary morphogenesis disrupted, abnormal WT + MO2-cdc42se1 + MO2-grhl2b standard conditions Fig. 5 with image from Dworkin et al., 2012
ventricular system development disrupted, abnormal WT + MO2-cdc42se1 + MO2-grhl2b standard conditions Fig. 5 with image from Dworkin et al., 2012
midbrain hindbrain boundary morphology, abnormal WT + MO2-cdc42se1 + MO2-grhl2b standard conditions Fig. 5 with image from Dworkin et al., 2012
trunk shortened, abnormal WT + MO2-grhl2a + MO2-grhl2b standard conditions Fig. S6 with image from Dworkin et al., 2012
notochord undulate, abnormal WT + MO2-grhl2a + MO2-grhl2b standard conditions Fig. S6 with image from Dworkin et al., 2012
post-vent region deformed, abnormal WT + MO2-grhl2a + MO2-grhl2b standard conditions Fig. S6 with image from Dworkin et al., 2012
midbrain hindbrain boundary morphology, abnormal WT + MO2-grhl2a + MO2-grhl2b standard conditions Fig. S6 with image from Dworkin et al., 2012
Citations