Morpholino

MO2-foxa3

ID

ZDB-MRPHLNO-110304-2

Name

MO2-foxa3

Previous Names

MO-gamma1-FoxA3 (1)

Target

foxa3 (1)

Sequence

5' - AGCTCAACATCCCCAAATAAAGTTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-foxa3

No data available

Phenotype

Phenotype resulting from MO2-foxa3

No data available

Phenotype of all Fish created by or utilizing MO2-foxa3

Phenotype	Fish	Conditions	Figures
hatching gland aplastic, abnormal	WT + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 , Fig. 2 , Fig. S7 from Dal-Pra et al., 2011
anterior axial hypoblast morphology, abnormal	WT + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 2 from Dal-Pra et al., 2011
notochord disorganized, abnormal	WT + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 2 from Dal-Pra et al., 2011
axial chorda mesoderm decreased width, abnormal	WT + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 3 from Dal-Pra et al., 2011
prechordal plate poorly differentiated, abnormal	WT + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 2 from Dal-Pra et al., 2011
paraxial mesoderm increased area, abnormal	WT + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 3 from Dal-Pra et al., 2011
axial chorda mesoderm decreased width, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 3 , Fig. 8 from Dal-Pra et al., 2011
notochord posterior region truncated, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 , Fig. S2 from Dal-Pra et al., 2011
somite fused with somite, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 from Dal-Pra et al., 2011
notochord cell decreased size, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. S1 from Dal-Pra et al., 2011
hypochord decreased length, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 , Fig. S2 from Dal-Pra et al., 2011
notochord cell mislocalised, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 , Fig. S1 from Dal-Pra et al., 2011
hypochord disorganized, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 , Fig. 8 , Fig. S2 from Dal-Pra et al., 2011
floor plate disorganized, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 , Fig. 8 , Fig. S2 from Dal-Pra et al., 2011
paraxial mesoderm increased area, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 3 , Fig. 8 from Dal-Pra et al., 2011
floor plate cell elongated, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. S1 from Dal-Pra et al., 2011
axial chorda mesoderm aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 3 from Dal-Pra et al., 2011
floor plate decreased length, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 , Fig. S2 from Dal-Pra et al., 2011
notochord disorganized, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 , Fig. 8 , Fig. S2 from Dal-Pra et al., 2011
hypochord aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa1 + MO2-foxa3	standard conditions	Fig. S2 from Dal-Pra et al., 2011
notochord aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa1 + MO2-foxa3	standard conditions	Fig. S2 from Dal-Pra et al., 2011
floor plate aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa1 + MO2-foxa3	standard conditions	Fig. S2 from Dal-Pra et al., 2011
paraxial mesoderm increased area, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto	standard conditions	Fig. 8 from Dal-Pra et al., 2011
hypochord aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto	standard conditions	Fig. 8 from Dal-Pra et al., 2011
floor plate aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto	standard conditions	Fig. 8 from Dal-Pra et al., 2011
axial chorda mesoderm aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto	standard conditions	Fig. 8 from Dal-Pra et al., 2011
notochord aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto	standard conditions	Fig. 8 from Dal-Pra et al., 2011
paraxial mesoderm left side fused with paraxial mesoderm right side, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto	standard conditions	Fig. 8 from Dal-Pra et al., 2011

Citations