Morpholino

MO2-cdc14b

ID

ZDB-MRPHLNO-110118-2

Name

MO2-cdc14b

Previous Names

MORPH1736 (1)

Target

cdc14b (1)

Sequence

5' - CTCGCTTCAACTAAAAACAAAGAGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-cdc14b

No data available

Phenotype

Phenotype resulting from MO2-cdc14b

Phenotype	Fish	Figures
brain hydrocephalic, abnormal	WT + MO2-cdc14b	Fig. 1 from Clément et al., 2011
embryonic heart tube left/right pattern formation disrupted, abnormal	WT + MO2-cdc14b	Fig. 2 from Clément et al., 2011
heart looping disrupted, abnormal	WT + MO2-cdc14b	Fig. 2 from Clément et al., 2011
Kupffer's vesicle cilium decreased length, abnormal	s870Tg + MO2-cdc14b	Fig. 3 from Clément et al., 2011
Kupffer's vesicle cilium increased amount, abnormal	s870Tg + MO2-cdc14b	Fig. 3 from Clément et al., 2011
left/right pattern formation occurrence, abnormal	WT + MO2-cdc14b	Fig. 2 from Clément et al., 2011
pericardium edematous, abnormal	WT + MO2-cdc14b	Fig. 1 from Clément et al., 2011
post-vent region curved ventral, abnormal	WT + MO2-cdc14b	Fig. 1 from Clément et al., 2011
pronephric duct cilium decreased length, abnormal	WT + MO2-cdc14b	Fig. 4 from Clément et al., 2011

Phenotype of all Fish created by or utilizing MO2-cdc14b

Phenotype	Fish	Conditions	Figures
pericardium edematous, abnormal	WT + MO2-cdc14b	standard conditions	Fig. 1 from Clément et al., 2011
post-vent region curved ventral, abnormal	WT + MO2-cdc14b	standard conditions	Fig. 1 from Clément et al., 2011
heart looping disrupted, abnormal	WT + MO2-cdc14b	standard conditions	Fig. 2 from Clément et al., 2011
embryonic heart tube left/right pattern formation disrupted, abnormal	WT + MO2-cdc14b	standard conditions	Fig. 2 from Clément et al., 2011
pronephric duct cilium decreased length, abnormal	WT + MO2-cdc14b	standard conditions	Fig. 4 from Clément et al., 2011
left/right pattern formation occurrence, abnormal	WT + MO2-cdc14b	standard conditions	Fig. 2 from Clément et al., 2011
brain hydrocephalic, abnormal	WT + MO2-cdc14b	standard conditions	Fig. 1 from Clément et al., 2011
pronephric duct cilium decreased length, abnormal	WT + MO2-cdc14b + MO3-cdc14b	standard conditions	Fig. 4 from Clément et al., 2011
post-vent region curved ventral, abnormal	WT + MO2-cdc14b + MO3-cdc14b	standard conditions	Fig. 1 from Clément et al., 2011
pericardium edematous, abnormal	WT + MO2-cdc14b + MO3-cdc14b	standard conditions	Fig. 1 from Clément et al., 2011
pronephric duct cilium decreased amount, abnormal	WT + MO2-cdc14b + MO3-cdc14b	standard conditions	Fig. 4 from Clément et al., 2011
brain hydrocephalic, abnormal	WT + MO2-cdc14b + MO3-cdc14b	standard conditions	Fig. 1 from Clément et al., 2011
Kupffer's vesicle cilium increased amount, abnormal	s870Tg + MO2-cdc14b	standard conditions	Fig. 3 from Clément et al., 2011
Kupffer's vesicle cilium decreased length, abnormal	s870Tg + MO2-cdc14b	standard conditions	Fig. 3 from Clément et al., 2011
Kupffer's vesicle cilium increased amount, abnormal	s870Tg + MO2-cdc14b + MO3-cdc14b	standard conditions	Fig. 3 from Clément et al., 2011
Kupffer's vesicle cilium decreased length, abnormal	s870Tg + MO2-cdc14b + MO3-cdc14b	standard conditions	Fig. 3 from Clément et al., 2011

Citations