Morpholino

MO1-klf2a

ID
ZDB-MRPHLNO-100610-8
Name
MO1-klf2a
Previous Names
  • klf2a ATG (1)
Target
Sequence
5' - GGACCTGTCCAGTTCATCCTTCCAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-klf2a
Expressed Gene Anatomy Figures
acvrl1 Fig. S2 with image from Corti et al., 2011
aldh1a2 Fig. 5 with image from Kotkamp et al., 2014
capn9 Fig. 6 with image from Kotkamp et al., 2014
cavin2b Fig. 6 with image from Kotkamp et al., 2014
cdh5 Fig. 3 from Nicoli et al., 2010
cxcr4a Fig. S2 with image from Corti et al., 2011
dbh Fig. 7 with image from Chou et al., 2014
dlc Fig. 5 with image from Kotkamp et al., 2014
edn1 Fig. S2 with image from Corti et al., 2011
efnb2a Fig. 6 from Wang et al., 2011
her1 Fig. 5 with image from Kotkamp et al., 2014
her7 Fig. 5 with image from Kotkamp et al., 2014
kdrl Fig. 4,  Fig. 5 from Xie et al., 2018
klf2a Fig. 6 with image from Kotkamp et al., 2014
Fig. S2 with image from Corti et al., 2011
Fig. 5 from Wang et al., 2011
klf2b Fig. 6 with image from Kotkamp et al., 2014
klf17 Fig. 6 with image from Kotkamp et al., 2014
krt4 Fig. 6 with image from Kotkamp et al., 2014
krt5 Fig. 6 with image from Kotkamp et al., 2014
krt17 Fig. 6 with image,  Fig. 7 with image from Kotkamp et al., 2014
krt91 Fig. 6 with image from Kotkamp et al., 2014
mespaa Fig. 5 with image from Kotkamp et al., 2014
mir126a Fig. 3 from Nicoli et al., 2010
msgn1 Fig. 5 with image from Kotkamp et al., 2014
myb Fig. 6 from Wang et al., 2011
nos1 Fig. 7 from Wang et al., 2011
nos2b Fig. 7 from Wang et al., 2011
nr5a1a Fig. 7 with image from Chou et al., 2014
pcdh8 Fig. 5 with image from Kotkamp et al., 2014
prph Fig. 6 with image from Kotkamp et al., 2014
rag1 Fig. 6 from Wang et al., 2011
runx1 Fig. 6,  Fig. 7 from Wang et al., 2011
slc14a2 Fig. 6 with image from Kotkamp et al., 2014
tagln2 Fig. 6 with image from Kotkamp et al., 2014
Phenotype
Phenotype resulting from MO1-klf2a
Phenotype Fish Figures
adrenal gland development process quality, abnormal s843Tg + MO1-klf2a Fig. 5 with image,  Fig. 7 with image from Chou et al., 2014
aortic arch 5 absent, abnormal la116Tg + MO1-klf2a Fig. 2 from Nicoli et al., 2010
caudal vein plexus kdrl expression decreased distribution, abnormal WT + MO1-klf2a Fig. 4,  Fig. 5 from Xie et al., 2018
caudal vein plexus malformed, abnormal s843Tg + MO1-klf2a Fig. 4,  Fig. 5 from Xie et al., 2018
caudal vein plexus sprouting angiogenesis decreased occurrence, abnormal s843Tg + MO1-klf2a Fig. 4,  Fig. 5 from Xie et al., 2018
hematopoietic multipotent progenitor cell decreased amount, abnormal WT + MO1-klf2a Fig. 6,  Fig. 7 from Wang et al., 2011
interrenal angiogenic sprout decreased length, abnormal s843Tg + MO1-klf2a Fig. 5 with image from Chou et al., 2014
interrenal gland position, abnormal s843Tg + MO1-klf2a Fig. 5 with image from Chou et al., 2014
interrenal gland animal organ morphogenesis process quality, abnormal s843Tg + MO1-klf2a Fig. 5 with image,  Fig. 7 with image from Chou et al., 2014
interrenal gland epithelial to mesenchymal transition decreased occurrence, abnormal zf346Tg + MO1-klf2a Fig. 6 with image from Chou et al., 2014
margin presumptive mesoderm differentiated, abnormal AB/TL + MO1-klf2a Fig. 5 with image from Kotkamp et al., 2014
mesodermal cell fate specification increased process quality, abnormal AB/TL + MO1-klf2a Fig. 5 with image from Kotkamp et al., 2014
nitric oxide biosynthetic process disrupted, abnormal WT + MO1-klf2a Fig. 7 from Wang et al., 2011
thymus hematopoietic multipotent progenitor cell decreased amount, abnormal WT + MO1-klf2a Fig. 6 from Wang et al., 2011
Phenotype of all Fish created by or utilizing MO1-klf2a
Phenotype Fish Conditions Figures
margin presumptive mesoderm differentiated, abnormal AB/TL + MO1-klf2a standard conditions Fig. 5 with image from Kotkamp et al., 2014
mesodermal cell fate specification increased process quality, abnormal AB/TL + MO1-klf2a standard conditions Fig. 5 with image from Kotkamp et al., 2014
interrenal gland animal organ morphogenesis process quality, abnormal WT + MO1-klf2a standard conditions Fig. 7 with image from Chou et al., 2014
adrenal gland development process quality, abnormal WT + MO1-klf2a standard conditions Fig. 7 with image from Chou et al., 2014
hematopoietic multipotent progenitor cell decreased amount, abnormal WT + MO1-klf2a standard conditions Fig. 6,  Fig. 7 from Wang et al., 2011
nitric oxide biosynthetic process disrupted, abnormal WT + MO1-klf2a standard conditions Fig. 7 from Wang et al., 2011
thymus hematopoietic multipotent progenitor cell decreased amount, abnormal WT + MO1-klf2a standard conditions Fig. 6 from Wang et al., 2011
caudal vein plexus kdrl expression decreased distribution, abnormal WT + MO1-klf2a control Fig. 4,  Fig. 5 from Xie et al., 2018
aortic arch 5 absent, abnormal la116Tg + MO1-klf2a standard conditions Fig. 2 from Nicoli et al., 2010
interrenal gland position, abnormal s843Tg + MO1-klf2a standard conditions Fig. 5 with image from Chou et al., 2014
caudal vein plexus sprouting angiogenesis decreased occurrence, abnormal s843Tg + MO1-klf2a control Fig. 4,  Fig. 5 from Xie et al., 2018
interrenal gland animal organ morphogenesis process quality, abnormal s843Tg + MO1-klf2a standard conditions Fig. 5 with image from Chou et al., 2014
caudal vein plexus malformed, abnormal s843Tg + MO1-klf2a standard conditions Fig. 4,  Fig. 5 from Xie et al., 2018
adrenal gland development process quality, abnormal s843Tg + MO1-klf2a standard conditions Fig. 5 with image from Chou et al., 2014
interrenal angiogenic sprout decreased length, abnormal s843Tg + MO1-klf2a standard conditions Fig. 5 with image from Chou et al., 2014
interrenal gland epithelial to mesenchymal transition decreased occurrence, abnormal zf346Tg + MO1-klf2a standard conditions Fig. 6 with image from Chou et al., 2014
margin presumptive mesoderm differentiated, abnormal AB/TL + MO1-klf2a + MO1-klf2b standard conditions Fig. 5 with image from Kotkamp et al., 2014
mesodermal cell fate specification increased process quality, abnormal AB/TL + MO1-klf2a + MO1-klf2b standard conditions Fig. 5 with image from Kotkamp et al., 2014
EVL poorly differentiated, abnormal AB/TL + MO1-klf17 + MO1-klf2a standard conditions Fig. 7 with image from Kotkamp et al., 2014
aortic arch 5 absent, abnormal la116Tg + MO1-klf2a + MO1-mir126 standard conditions Fig. 3 from Nicoli et al., 2010
heart size, ameliorated y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 + MO1-klf2a + MO2-klf2b control Figure 5 with image from Li et al., 2021
caudal vein plexus size, ameliorated y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 + MO1-klf2a + MO2-klf2b control Figure 5 with image from Li et al., 2021
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.