Morpholino

MO1-klf2a

ID
ZDB-MRPHLNO-100610-8
Name
MO1-klf2a
Previous Names
  • klf2a ATG (1)
Target
Sequence
5' - GGACCTGTCCAGTTCATCCTTCCAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-klf2a
No data available
Phenotype
Phenotype resulting from MO1-klf2a
Phenotype Fish Figures
adrenal gland development process quality, abnormal WT + MO1-klf2a Fig. 5 with imageFig. 7 with image from Chou et al., 2014
aortic arch 5 absent, abnormal la116Tg + MO1-klf2a Fig. 2 from Nicoli et al., 2010
caudal vein plexus kdrl expression decreased distribution, abnormal WT + MO1-klf2a Fig. 4Fig. 5 from Xie et al., 2018
caudal vein plexus malformed, abnormal s843Tg + MO1-klf2a Fig. 4Fig. 5 from Xie et al., 2018
caudal vein plexus sprouting angiogenesis decreased occurrence, abnormal s843Tg + MO1-klf2a Fig. 4Fig. 5 from Xie et al., 2018
hematopoietic multipotent progenitor cell decreased amount, abnormal WT + MO1-klf2a Fig. 6Fig. 7 from Wang et al., 2011
interrenal angiogenic sprout decreased length, abnormal s843Tg + MO1-klf2a Fig. 5 with image from Chou et al., 2014
interrenal gland position, abnormal s843Tg + MO1-klf2a Fig. 5 with image from Chou et al., 2014
interrenal gland animal organ morphogenesis process quality, abnormal WT + MO1-klf2a Fig. 5 with imageFig. 7 with image from Chou et al., 2014
interrenal gland epithelial to mesenchymal transition decreased occurrence, abnormal zf346Tg + MO1-klf2a Fig. 6 with image from Chou et al., 2014
margin presumptive mesoderm differentiated, abnormal AB/TL + MO1-klf2a Fig. 5 with image from Kotkamp et al., 2014
mesodermal cell fate specification increased process quality, abnormal AB/TL + MO1-klf2a Fig. 5 with image from Kotkamp et al., 2014
nitric oxide biosynthetic process disrupted, abnormal WT + MO1-klf2a Fig. 7 from Wang et al., 2011
thymus hematopoietic multipotent progenitor cell decreased amount, abnormal WT + MO1-klf2a Fig. 6 from Wang et al., 2011
Phenotype of all Fish created by or utilizing MO1-klf2a
Phenotype Fish Conditions Figures
margin presumptive mesoderm differentiated, abnormal AB/TL + MO1-klf2a standard conditions Fig. 5 with image from Kotkamp et al., 2014
mesodermal cell fate specification increased process quality, abnormal AB/TL + MO1-klf2a standard conditions Fig. 5 with image from Kotkamp et al., 2014
interrenal gland animal organ morphogenesis process quality, abnormal WT + MO1-klf2a standard conditions Fig. 7 with image from Chou et al., 2014
adrenal gland development process quality, abnormal WT + MO1-klf2a standard conditions Fig. 7 with image from Chou et al., 2014
hematopoietic multipotent progenitor cell decreased amount, abnormal WT + MO1-klf2a standard conditions Fig. 6Fig. 7 from Wang et al., 2011
nitric oxide biosynthetic process disrupted, abnormal WT + MO1-klf2a standard conditions Fig. 7 from Wang et al., 2011
thymus hematopoietic multipotent progenitor cell decreased amount, abnormal WT + MO1-klf2a standard conditions Fig. 6 from Wang et al., 2011
caudal vein plexus kdrl expression decreased distribution, abnormal WT + MO1-klf2a control Fig. 4Fig. 5 from Xie et al., 2018
aortic arch 5 absent, abnormal la116Tg + MO1-klf2a standard conditions Fig. 2 from Nicoli et al., 2010
interrenal gland position, abnormal s843Tg + MO1-klf2a standard conditions Fig. 5 with image from Chou et al., 2014
caudal vein plexus sprouting angiogenesis decreased occurrence, abnormal s843Tg + MO1-klf2a standard conditions Fig. 4Fig. 5 from Xie et al., 2018
interrenal gland animal organ morphogenesis process quality, abnormal s843Tg + MO1-klf2a standard conditions Fig. 5 with image from Chou et al., 2014
caudal vein plexus malformed, abnormal s843Tg + MO1-klf2a control Fig. 4Fig. 5 from Xie et al., 2018
adrenal gland development process quality, abnormal s843Tg + MO1-klf2a standard conditions Fig. 5 with image from Chou et al., 2014
interrenal angiogenic sprout decreased length, abnormal s843Tg + MO1-klf2a standard conditions Fig. 5 with image from Chou et al., 2014
interrenal gland epithelial to mesenchymal transition decreased occurrence, abnormal zf346Tg + MO1-klf2a standard conditions Fig. 6 with image from Chou et al., 2014
margin presumptive mesoderm differentiated, abnormal AB/TL + MO1-klf2a + MO1-klf2b standard conditions Fig. 5 with image from Kotkamp et al., 2014
mesodermal cell fate specification increased process quality, abnormal AB/TL + MO1-klf2a + MO1-klf2b standard conditions Fig. 5 with image from Kotkamp et al., 2014
EVL poorly differentiated, abnormal AB/TL + MO1-klf17 + MO1-klf2a standard conditions Fig. 7 with image from Kotkamp et al., 2014
aortic arch 5 absent, abnormal la116Tg + MO1-klf2a + MO1-mir126 standard conditions Fig. 3 from Nicoli et al., 2010
heart size, ameliorated y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 + MO1-klf2a + MO2-klf2b control Figure 5 with image from Li et al., 2021
caudal vein plexus size, ameliorated y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 + MO1-klf2a + MO2-klf2b control Figure 5 with image from Li et al., 2021
Citations