Morpholino

MO1-klf2a

ID
ZDB-MRPHLNO-100610-8
Name
MO1-klf2a
Previous Names
  • klf2a ATG (1)
Target
Sequence
5' - GGACCTGTCCAGTTCATCCTTCCAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-klf2a
Expressed Gene Anatomy Figures
acvrl1 Fig. S2 with image from Corti et al., 2011
aldh1a2 Fig. 5 with image from Kotkamp et al., 2014
capn9 Fig. 6 with image from Kotkamp et al., 2014
cavin2b Fig. 6 with image from Kotkamp et al., 2014
cdh5 Fig. 3 from Nicoli et al., 2010
cxcr4a Fig. S2 with image from Corti et al., 2011
dbh Fig. 7 with image from Chou et al., 2014
dlc Fig. 5 with image from Kotkamp et al., 2014
edn1 Fig. S2 with image from Corti et al., 2011
efnb2a Fig. 6 from Wang et al., 2011
her1 Fig. 5 with image from Kotkamp et al., 2014
her7 Fig. 5 with image from Kotkamp et al., 2014
kdrl Fig. 4Fig. 5 from Xie et al., 2018
klf2a Fig. 6 with image from Kotkamp et al., 2014
Fig. S2 with image from Corti et al., 2011
Fig. 5 from Wang et al., 2011
klf2b Fig. 6 with image from Kotkamp et al., 2014
klf17 Fig. 6 with image from Kotkamp et al., 2014
krt4 Fig. 6 with image from Kotkamp et al., 2014
krt5 Fig. 6 with image from Kotkamp et al., 2014
krt17 Fig. 6 with imageFig. 7 with image from Kotkamp et al., 2014
krt91 Fig. 6 with image from Kotkamp et al., 2014
mespaa Fig. 5 with image from Kotkamp et al., 2014
mir126a Fig. 3 from Nicoli et al., 2010
msgn1 Fig. 5 with image from Kotkamp et al., 2014
myb Fig. 6 from Wang et al., 2011
nos1 Fig. 7 from Wang et al., 2011
nos2b Fig. 7 from Wang et al., 2011
nr5a1a Fig. 7 with image from Chou et al., 2014
pcdh8 Fig. 5 with image from Kotkamp et al., 2014
prph Fig. 6 with image from Kotkamp et al., 2014
rag1 Fig. 6 from Wang et al., 2011
runx1 Fig. 6Fig. 7 from Wang et al., 2011
slc14a2 Fig. 6 with image from Kotkamp et al., 2014
tagln2 Fig. 6 with image from Kotkamp et al., 2014
Phenotype
Phenotype resulting from MO1-klf2a
Phenotype Fish Figures
adrenal gland development process quality, abnormal s843Tg + MO1-klf2a Fig. 5 with imageFig. 7 with image from Chou et al., 2014
aortic arch 5 absent, abnormal la116Tg + MO1-klf2a Fig. 2 from Nicoli et al., 2010
caudal vein plexus kdrl expression decreased distribution, abnormal WT + MO1-klf2a Fig. 4Fig. 5 from Xie et al., 2018
caudal vein plexus malformed, abnormal s843Tg + MO1-klf2a Fig. 4Fig. 5 from Xie et al., 2018
caudal vein plexus sprouting angiogenesis decreased occurrence, abnormal s843Tg + MO1-klf2a Fig. 4Fig. 5 from Xie et al., 2018
hematopoietic multipotent progenitor cell decreased amount, abnormal WT + MO1-klf2a Fig. 6Fig. 7 from Wang et al., 2011
interrenal angiogenic sprout decreased length, abnormal s843Tg + MO1-klf2a Fig. 5 with image from Chou et al., 2014
interrenal gland position, abnormal s843Tg + MO1-klf2a Fig. 5 with image from Chou et al., 2014
interrenal gland animal organ morphogenesis process quality, abnormal s843Tg + MO1-klf2a Fig. 5 with imageFig. 7 with image from Chou et al., 2014
interrenal gland epithelial to mesenchymal transition decreased occurrence, abnormal zf346Tg + MO1-klf2a Fig. 6 with image from Chou et al., 2014
margin presumptive mesoderm differentiated, abnormal AB/TL + MO1-klf2a Fig. 5 with image from Kotkamp et al., 2014
mesodermal cell fate specification increased process quality, abnormal AB/TL + MO1-klf2a Fig. 5 with image from Kotkamp et al., 2014
nitric oxide biosynthetic process disrupted, abnormal WT + MO1-klf2a Fig. 7 from Wang et al., 2011
thymus hematopoietic multipotent progenitor cell decreased amount, abnormal WT + MO1-klf2a Fig. 6 from Wang et al., 2011
Phenotype of all Fish created by or utilizing MO1-klf2a
Phenotype Fish Conditions Figures
margin presumptive mesoderm differentiated, abnormal AB/TL + MO1-klf2a standard conditions Fig. 5 with image from Kotkamp et al., 2014
mesodermal cell fate specification increased process quality, abnormal AB/TL + MO1-klf2a standard conditions Fig. 5 with image from Kotkamp et al., 2014
interrenal gland animal organ morphogenesis process quality, abnormal WT + MO1-klf2a standard conditions Fig. 7 with image from Chou et al., 2014
adrenal gland development process quality, abnormal WT + MO1-klf2a standard conditions Fig. 7 with image from Chou et al., 2014
hematopoietic multipotent progenitor cell decreased amount, abnormal WT + MO1-klf2a standard conditions Fig. 6Fig. 7 from Wang et al., 2011
nitric oxide biosynthetic process disrupted, abnormal WT + MO1-klf2a standard conditions Fig. 7 from Wang et al., 2011
thymus hematopoietic multipotent progenitor cell decreased amount, abnormal WT + MO1-klf2a standard conditions Fig. 6 from Wang et al., 2011
caudal vein plexus kdrl expression decreased distribution, abnormal WT + MO1-klf2a control Fig. 4Fig. 5 from Xie et al., 2018
aortic arch 5 absent, abnormal la116Tg + MO1-klf2a standard conditions Fig. 2 from Nicoli et al., 2010
interrenal gland position, abnormal s843Tg + MO1-klf2a standard conditions Fig. 5 with image from Chou et al., 2014
caudal vein plexus sprouting angiogenesis decreased occurrence, abnormal s843Tg + MO1-klf2a standard conditions Fig. 4Fig. 5 from Xie et al., 2018
interrenal gland animal organ morphogenesis process quality, abnormal s843Tg + MO1-klf2a standard conditions Fig. 5 with image from Chou et al., 2014
caudal vein plexus malformed, abnormal s843Tg + MO1-klf2a standard conditions Fig. 4Fig. 5 from Xie et al., 2018
adrenal gland development process quality, abnormal s843Tg + MO1-klf2a standard conditions Fig. 5 with image from Chou et al., 2014
interrenal angiogenic sprout decreased length, abnormal s843Tg + MO1-klf2a standard conditions Fig. 5 with image from Chou et al., 2014
interrenal gland epithelial to mesenchymal transition decreased occurrence, abnormal zf346Tg + MO1-klf2a standard conditions Fig. 6 with image from Chou et al., 2014
margin presumptive mesoderm differentiated, abnormal AB/TL + MO1-klf2a + MO1-klf2b standard conditions Fig. 5 with image from Kotkamp et al., 2014
mesodermal cell fate specification increased process quality, abnormal AB/TL + MO1-klf2a + MO1-klf2b standard conditions Fig. 5 with image from Kotkamp et al., 2014
EVL poorly differentiated, abnormal AB/TL + MO1-klf17 + MO1-klf2a standard conditions Fig. 7 with image from Kotkamp et al., 2014
aortic arch 5 absent, abnormal la116Tg + MO1-klf2a + MO1-mir126 standard conditions Fig. 3 from Nicoli et al., 2010
heart size, ameliorated y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 + MO1-klf2a + MO2-klf2b control Figure 5 with image from Li et al., 2021
caudal vein plexus size, ameliorated y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 + MO1-klf2a + MO2-klf2b control Figure 5 with image from Li et al., 2021
Citations