Morpholino
MO3-igf2b
- ID
- ZDB-MRPHLNO-100527-1
- Name
- MO3-igf2b
- Previous Names
- None
- Target
- Sequence
-
5' - AATGATGTTTTAGTTGGTCCTCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-igf2b
Expressed Gene | Anatomy | Figures |
---|---|---|
bmp2b |
Fig. S5
from Hartnett et al., 2010 |
|
bmp4 |
Fig. 6 ,
Fig. S5
from Hartnett et al., 2010 |
|
chrd |
Fig. S5
from Hartnett et al., 2010 |
|
dharma |
Fig. S3
from Hartnett et al., 2010 |
|
elnb |
Fig. 6
from Hartnett et al., 2010 |
|
fgf8a |
Fig. S3
from Hartnett et al., 2010 |
|
gata1a |
Fig. S6
from Hartnett et al., 2010 |
|
gata2a |
Fig. S5
from Hartnett et al., 2010 |
|
gsc |
Fig. S5
from Hartnett et al., 2010 |
|
notch1b |
Fig. 6
from Hartnett et al., 2010 |
|
pax6b |
Fig. S4
from Hartnett et al., 2010 |
|
rx3 |
Fig. S4
from Hartnett et al., 2010 |
|
tal1 |
Fig. S6
from Hartnett et al., 2010 |
Phenotype
Phenotype resulting from MO3-igf2b
Phenotype of all Fish created by or utilizing MO3-igf2b
Citations