header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100513-2
Morpholino Name: MO5-sdc2
Target: sdc2 (1)
Previous Name: MO(AUG) (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ATCCAAAGGTTCCTCATAATTCCTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO5-sdc2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO5-sdc2
Expressed Gene Anatomy Figures
dand5 Fig. 2 with image from Arrington et al., 2013
fgf2 Fig. 4 with image from Arrington et al., 2013
foxa3 Fig. 2 with image from Arrington et al., 2009
myl7 Fig. 2 with image from Arrington et al., 2009
sox17 Fig. 2 with image from Arrington et al., 2013
tbx16 Fig. 5 with image from Arrington et al., 2013
PHENOTYPE
Phenotype resulting from MO5-sdc2
Phenotype Figures
apical protein localization disrupted, abnormal Fig. 3 with image from Arrington et al., 2009
basement membrane organization disrupted, abnormal Fig. 3 with image from Arrington et al., 2009
cell migration involved in heart development disrupted, abnormal Fig. 2 with image from Arrington et al., 2009
determination of left/right asymmetry in lateral mesoderm process quality, abnormal Fig. 1 with image from Arrington et al., 2013
digestive tract development disrupted, abnormal Fig. 2 with image from Arrington et al., 2009
epithelial cilium movement involved in determination of left/right asymmetry process quality, abnormal Fig. 3 with image from Arrington et al., 2013
extension morphology, abnormal Fig. 2 with image from Arrington et al., 2009
forerunner cell group decreased size, abnormal Fig. 2 with image from Arrington et al., 2013
forerunner cell group physical object quality, abnormal Fig. 5 with image from Arrington et al., 2013
heart symmetry, abnormal Fig. 1 with image from Arrington et al., 2013
heart development disrupted, abnormal Fig. 2 with image from Arrington et al., 2009
heart looping process quality, abnormal Fig. 1 with image from Arrington et al., 2013
Kupffer's vesicle decreased size, abnormal Fig. 2 with imageFig. 6 with image from Arrington et al., 2013
Kupffer's vesicle malformed, abnormal Fig. 2 with imageFig. 6 with image from Arrington et al., 2013
Kupffer's vesicle physical object quality, abnormal Fig. 4 with image from Arrington et al., 2013
Kupffer's vesicle motile cilium decreased amount, abnormal Fig. 3 with imageFig. 6 with image from Arrington et al., 2013
Kupffer's vesicle motile cilium decreased length, abnormal Fig. 3 with imageFig. 6 with image from Arrington et al., 2013
Kupffer's vesicle development process quality, abnormal Fig. 2 with imageFig. 4 with imageFig. 6 with image from Arrington et al., 2013
lateral plate mesoderm symmetry, abnormal Fig. 1 with image from Arrington et al., 2013
pericardium edematous, abnormal Fig. 2 with image from Arrington et al., 2009
pigmentation decreased occurrence, abnormal Fig. 2 with image from Arrington et al., 2009
regulation of fibroblast growth factor receptor signaling pathway process quality, abnormal Fig. 4 with image from Arrington et al., 2013
supramolecular fiber organization disrupted, abnormal Fig. 4 with image from Arrington et al., 2009
whole organism decreased size, abnormal Fig. 2 with image from Arrington et al., 2009
yolk increased size, abnormal Fig. 2 with image from Arrington et al., 2009

Phenotype of all Fish created by or utilizing MO5-sdc2
Phenotype Fish Conditions Figures
heart symmetry, abnormal AB + MO5-sdc2 standard conditions Fig. 1 with image from Arrington et al., 2013
extension morphology, abnormal AB + MO5-sdc2 standard conditions Fig. 2 with image from Arrington et al., 2009
pericardium edematous, abnormal AB + MO5-sdc2 standard conditions Fig. 2 with image from Arrington et al., 2009
determination of left/right asymmetry in lateral mesoderm process quality, abnormal AB + MO5-sdc2 standard conditions Fig. 1 with image from Arrington et al., 2013
pigmentation decreased occurrence, abnormal AB + MO5-sdc2 standard conditions Fig. 2 with image from Arrington et al., 2009
heart development disrupted, abnormal AB + MO5-sdc2 standard conditions Fig. 2 with image from Arrington et al., 2009
Kupffer's vesicle motile cilium decreased length, abnormal AB + MO5-sdc2 standard conditions Fig. 3 with imageFig. 6 with image from Arrington et al., 2013
lateral plate mesoderm symmetry, abnormal AB + MO5-sdc2 standard conditions Fig. 1 with image from Arrington et al., 2013
Kupffer's vesicle motile cilium decreased amount, abnormal AB + MO5-sdc2 standard conditions Fig. 3 with imageFig. 6 with image from Arrington et al., 2013
epithelial cilium movement involved in determination of left/right asymmetry process quality, abnormal AB + MO5-sdc2 standard conditions Fig. 3 with image from Arrington et al., 2013
Kupffer's vesicle physical object quality, abnormal AB + MO5-sdc2 standard conditions Fig. 4 with image from Arrington et al., 2013
digestive tract development disrupted, abnormal AB + MO5-sdc2 standard conditions Fig. 2 with image from Arrington et al., 2009
cell migration involved in heart development disrupted, abnormal AB + MO5-sdc2 standard conditions Fig. 2 with image from Arrington et al., 2009
supramolecular fiber organization disrupted, abnormal AB + MO5-sdc2 standard conditions Fig. 4 with image from Arrington et al., 2009
Kupffer's vesicle motile cilium decreased length, abnormal AB + MO5-sdc2 chemical treatment: messenger RNA Fig. 6 with image from Arrington et al., 2013
Kupffer's vesicle malformed, abnormal AB + MO5-sdc2 standard conditions Fig. 2 with imageFig. 6 with image from Arrington et al., 2013
whole organism decreased size, abnormal AB + MO5-sdc2 standard conditions Fig. 2 with image from Arrington et al., 2009
Kupffer's vesicle decreased size, abnormal AB + MO5-sdc2 standard conditions Fig. 2 with imageFig. 6 with image from Arrington et al., 2013
basement membrane organization disrupted, abnormal AB + MO5-sdc2 standard conditions Fig. 3 with image from Arrington et al., 2009
heart looping process quality, abnormal AB + MO5-sdc2 standard conditions Fig. 1 with image from Arrington et al., 2013
yolk increased size, abnormal AB + MO5-sdc2 standard conditions Fig. 2 with image from Arrington et al., 2009
Kupffer's vesicle development process quality, abnormal AB + MO5-sdc2 standard conditions Fig. 2 with imageFig. 4 with imageFig. 6 with image from Arrington et al., 2013
forerunner cell group physical object quality, abnormal AB + MO5-sdc2 standard conditions Fig. 5 with image from Arrington et al., 2013
regulation of fibroblast growth factor receptor signaling pathway process quality, abnormal AB + MO5-sdc2 standard conditions Fig. 4 with image from Arrington et al., 2013
Kupffer's vesicle development process quality, abnormal s870Tg + MO5-sdc2 standard conditions Fig. 2 with image from Arrington et al., 2013
Kupffer's vesicle decreased size, abnormal s870Tg + MO5-sdc2 standard conditions Fig. 2 with image from Arrington et al., 2013
Kupffer's vesicle malformed, abnormal s870Tg + MO5-sdc2 standard conditions Fig. 2 with image from Arrington et al., 2013
forerunner cell group decreased size, abnormal s870Tg + MO5-sdc2 standard conditions Fig. 2 with image from Arrington et al., 2013
apical protein localization disrupted, abnormal twu34Tg + MO5-sdc2 standard conditions Fig. 3 with image from Arrington et al., 2009
basement membrane organization disrupted, abnormal twu34Tg + MO5-sdc2 standard conditions Fig. 3 with image from Arrington et al., 2009
determination of left/right asymmetry in lateral mesoderm process quality, abnormal AB + MO1-fgf2 + MO5-sdc2 standard conditions Fig. 4 with image from Arrington et al., 2013
determination of left/right asymmetry in lateral mesoderm process quality, abnormal AB + MO3-tbx16 + MO5-sdc2 standard conditions Fig. 5 with image from Arrington et al., 2013
OTHER MO5-sdc2 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)