Morpholino

MO2-sim1a

ID

ZDB-MRPHLNO-100423-10

Name

MO2-sim1a

Previous Names

sim1a (e2i2) (1)

Target

sim1a (1)

Sequence

5' - TGTGATTGTGTACCTGAAGCAGATG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

splice-blocker

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-sim1a

Expressed Gene	Anatomy	Figures
avp	(not) preoptic area neurosecretory neuron	Fig. 4 from Löhr et al., 2009
crhb	caudal tuberculum neurosecretory neuron diencephalon hindbrain hypothalamus neurosecretory neuron preoptic area neurosecretory neuron	Fig. 4 from Löhr et al., 2009
oxt	(not) preoptic area neurosecretory neuron	Fig. 4 from Löhr et al., 2009
ppargc1a	pronephric duct	Fig. 5 from Chambers et al., 2018
robo3	hypothalamus posterior region	Fig. 4 from Schweitzer et al., 2013
slc12a1	pronephric distal early tubule	Fig. 3 from Cheng et al., 2015
slc12a3	pronephric distal late tubule	Fig. 3 from Cheng et al., 2015
slc20a1a	pronephric proximal convoluted tubule	Fig. 3 from Cheng et al., 2015
sst1.1	diencephalon hindbrain midbrain preoptic area neurosecretory neuron	Fig. 4 from Löhr et al., 2009
stc1	(not) corpuscles of Stannius	Fig. 3 from Cheng et al., 2015
th	caudal tuberculum dopaminergic neuron hypothalamus dopaminergic neuron preoptic area dopaminergic neuron pretectum dopaminergic neuron telencephalon dopaminergic neuron	Fig. 3 from Löhr et al., 2009
trh	hindbrain (not) preoptic area neurosecretory neuron	Fig. 4 from Löhr et al., 2009
trpm7	(not) pronephric proximal straight tubule	Fig. 5 from Chambers et al., 2018 Fig. 3 from Cheng et al., 2015
uts1	hypothalamus posterior region	Fig. 7 from Wolf et al., 2013
vip	hypothalamus posterior region	Fig. 7 from Wolf et al., 2013

Phenotype

Phenotype resulting from MO2-sim1a

Phenotype	Fish	Figures
caudal tuberculum dopaminergic neuron decreased amount, abnormal	WT + MO2-sim1a	Fig. 3 from Löhr et al., 2009
caudal tuberculum neurosecretory neuron decreased amount, abnormal	WT + MO2-sim1a	Fig. 4 from Löhr et al., 2009
corpuscles of Stannius stc1 expression absent, abnormal	TU + MO2-sim1a	Fig. 3 from Cheng et al., 2015
diencephalic nucleus axon displaced to hindbrain medial region, abnormal	zc49Tg + MO2-sim1a	Fig. 1 , Fig. 7 from Schweitzer et al., 2013
diencephalon neurosecretory neuron mislocalised, abnormal	WT + MO2-sim1a	Fig. 4 from Löhr et al., 2009
dopaminergic neuron axon displaced to hindbrain medial region, abnormal	WT + MO2-sim1a	Fig. 2 from Schweitzer et al., 2013
dopaminergic neuron differentiation process quality, abnormal	WT + MO2-sim1a	Fig. 3 from Löhr et al., 2009
hypothalamus dopaminergic neuron decreased amount, abnormal	WT + MO2-sim1a	Fig. 3 from Löhr et al., 2009
hypothalamus neurosecretory neuron decreased amount, abnormal	WT + MO2-sim1a	Fig. 4 from Löhr et al., 2009
hypothalamus cell differentiation process quality, abnormal	WT + MO2-sim1a	Fig. 4 from Löhr et al., 2009
preoptic area neurosecretory neuron decreased amount, abnormal	WT + MO2-sim1a	Fig. 4 from Löhr et al., 2009
pronephric duct ppargc1a expression increased distribution, abnormal	TU + MO2-sim1a	Fig. 5 from Chambers et al., 2018
pronephric proximal convoluted tubule distended, abnormal	TU + MO2-sim1a	Fig. 3 from Cheng et al., 2015
pronephric proximal convoluted tubule slc20a1a expression increased distribution, abnormal	TU + MO2-sim1a	Fig. 3 from Cheng et al., 2015
pronephric proximal convoluted tubule slc20a1a expression mislocalised, abnormal	TU + MO2-sim1a	Fig. 3 from Cheng et al., 2015
pronephric proximal convoluted tubule mislocalised posteriorly, abnormal	TU + MO2-sim1a	Fig. 3 from Cheng et al., 2015
pronephric proximal straight tubule trpm7 expression absent, abnormal	TU + MO2-sim1a	Fig. 5 from Chambers et al., 2018 Fig. 3 from Cheng et al., 2015
pronephric proximal straight tubule decreased size, abnormal	TU + MO2-sim1a	Fig. 3 from Cheng et al., 2015
pronephric proximal tubule morphogenesis decreased process quality, abnormal	TU + MO2-sim1a	Fig. 3 from Cheng et al., 2015
pronephric proximal tubule morphogenesis process quality, abnormal	TU + MO2-sim1a	Fig. 3 from Cheng et al., 2015
pronephros lacks all parts of type corpuscles of Stannius, abnormal	TU + MO2-sim1a	Fig. 3 from Cheng et al., 2015

Phenotype of all Fish created by or utilizing MO2-sim1a

Phenotype	Fish	Conditions	Figures
pronephric proximal convoluted tubule slc20a1a expression mislocalised, abnormal	TU + MO2-sim1a	standard conditions	Fig. 3 from Cheng et al., 2015
pronephric proximal convoluted tubule slc20a1a expression increased distribution, abnormal	TU + MO2-sim1a	standard conditions	Fig. 3 from Cheng et al., 2015
pronephric proximal straight tubule decreased size, abnormal	TU + MO2-sim1a	standard conditions	Fig. 3 from Cheng et al., 2015
pronephric proximal convoluted tubule distended, abnormal	TU + MO2-sim1a	standard conditions	Fig. 3 from Cheng et al., 2015
pronephric duct ppargc1a expression increased distribution, abnormal	TU + MO2-sim1a	control	Fig. 5 from Chambers et al., 2018
pronephric proximal convoluted tubule mislocalised posteriorly, abnormal	TU + MO2-sim1a	standard conditions	Fig. 3 from Cheng et al., 2015
pronephric proximal tubule morphogenesis process quality, abnormal	TU + MO2-sim1a	standard conditions	Fig. 3 from Cheng et al., 2015
pronephros lacks all parts of type corpuscles of Stannius, abnormal	TU + MO2-sim1a	standard conditions	Fig. 3 from Cheng et al., 2015
corpuscles of Stannius stc1 expression absent, abnormal	TU + MO2-sim1a	standard conditions	Fig. 3 from Cheng et al., 2015
pronephric proximal tubule morphogenesis decreased process quality, abnormal	TU + MO2-sim1a	standard conditions	Fig. 3 from Cheng et al., 2015
pronephric proximal straight tubule trpm7 expression absent, abnormal	TU + MO2-sim1a	control	Fig. 5 from Chambers et al., 2018 Fig. 3 from Cheng et al., 2015
dopaminergic neuron differentiation process quality, abnormal	WT + MO2-sim1a	standard conditions	Fig. 3 from Löhr et al., 2009
caudal tuberculum neurosecretory neuron decreased amount, abnormal	WT + MO2-sim1a	standard conditions	Fig. 4 from Löhr et al., 2009
preoptic area neurosecretory neuron decreased amount, abnormal	WT + MO2-sim1a	standard conditions	Fig. 4 from Löhr et al., 2009
diencephalon neurosecretory neuron mislocalised, abnormal	WT + MO2-sim1a	standard conditions	Fig. 4 from Löhr et al., 2009
hypothalamus cell differentiation process quality, abnormal	WT + MO2-sim1a	standard conditions	Fig. 4 from Löhr et al., 2009
caudal tuberculum dopaminergic neuron decreased amount, abnormal	WT + MO2-sim1a	standard conditions	Fig. 3 from Löhr et al., 2009
hypothalamus neurosecretory neuron decreased amount, abnormal	WT + MO2-sim1a	standard conditions	Fig. 4 from Löhr et al., 2009
hypothalamus dopaminergic neuron decreased amount, abnormal	WT + MO2-sim1a	standard conditions	Fig. 3 from Löhr et al., 2009
dopaminergic neuron axon displaced to hindbrain medial region, abnormal	WT + MO2-sim1a	standard conditions	Fig. 2 from Schweitzer et al., 2013
diencephalic nucleus axon displaced to hindbrain medial region, abnormal	zc49Tg + MO2-sim1a	standard conditions	Fig. 1 , Fig. 7 from Schweitzer et al., 2013
pronephric proximal straight tubule trpm7 expression spatial pattern, ameliorated	ppargc1a^{sa13186/sa13186} + MO2-sim1a	control	Fig. 5 from Chambers et al., 2018
pronephric proximal straight tubule trpm7 expression amount, ameliorated	ppargc1a^{sa13186/sa13186} + MO2-sim1a	control	Fig. 5 from Chambers et al., 2018
diencephalic nucleus axon displaced to hindbrain medial region, abnormal	zc49Tg + MO2-sim1a + MO3-arnt2	standard conditions	Fig. 1 from Schweitzer et al., 2013
diencephalic nucleus axon displaced to hindbrain medial region, abnormal	robo2^{ti272z/ti272z}; robo3^tw204/+; zc49Tg + MO2-sim1a	standard conditions	Fig. 8 from Schweitzer et al., 2013
diencephalic nucleus axon displaced to hindbrain medial region, abnormal	robo2^{ti272z/ti272z}; robo3^tw204/tw204; zc49Tg + MO2-sim1a	standard conditions	Fig. 8 from Schweitzer et al., 2013

Citations