Morpholino

MO1-mych

ID
ZDB-MRPHLNO-080822-3
Name
MO1-mych
Previous Names
  • mych UTR MO (1)
Target
Sequence
5' - ACTGTGGTGATAAAAGTAGACGGAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mych
Expressed Gene Anatomy Figures
barhl2 Fig. 4 with image from Hong et al., 2008
ctslb Fig. 4 with image from Hong et al., 2008
dlx2a Fig. 7 with image from Hong et al., 2008
dlx3b Fig. 4 with image from Hong et al., 2008
dmbx1a Fig. 4 with image from Hong et al., 2008
egr2b Fig. 4 with image from Hong et al., 2008
eve1 Fig. 5 with image from Hong et al., 2008
foxd3 Fig. 6 with image from Hong et al., 2008
hand2 Fig. 7 with image from Hong et al., 2008
hesx1 Fig. 5 with image from Hong et al., 2008
hoxb1b Fig. 5 with image from Hong et al., 2008
mab21l2 Fig. 4 with image from Hong et al., 2008
myod1 text only from Hong et al., 2008
otx2b Fig. 5 with image from Hong et al., 2008
pax2a Fig. 4 with image from Hong et al., 2008
pcdh8 Fig. 4 with image from Hong et al., 2008
rx3 Fig. 4 with image from Hong et al., 2008
six3a Fig. 5 with image from Hong et al., 2008
snai1b Fig. 6 with image from Hong et al., 2008
sox9b Fig. 6 with image from Hong et al., 2008
sox10 Fig. 6 with image from Hong et al., 2008
tbx1 Fig. 7 with imagetext only from Hong et al., 2008
tbxta Fig. 4 with image from Hong et al., 2008
zic1 Fig. 5 with image from Hong et al., 2008
Phenotype
Phenotype resulting from MO1-mych
Phenotype Fish Figures
cranial cartilage aplastic, abnormal AB + MO1-mych Fig. 7 with image from Hong et al., 2008
embryonic retina morphogenesis in camera-type eye disrupted, abnormal AB + MO1-mych Fig. 3 with image from Hong et al., 2008
endoderm development disrupted, abnormal AB + MO1-mych Fig. 7 with image from Hong et al., 2008
eye decreased size, abnormal AB + MO1-mych Fig. 4 with image from Hong et al., 2008
forebrain morphogenesis disrupted, abnormal AB + MO1-mych Fig. 5 with image from Hong et al., 2008
head decreased size, abnormal AB + MO1-mych Fig. 3 with image from Hong et al., 2008
hindbrain increased width, abnormal AB + MO1-mych Fig. 4 with image from Hong et al., 2008
mesoderm development disrupted, abnormal AB + MO1-mych Fig. 7 with image from Hong et al., 2008
midbrain increased width, abnormal AB + MO1-mych Fig. 4 with image from Hong et al., 2008
neural crest decreased thickness, abnormal AB + MO1-mych Fig. 6 with image from Hong et al., 2008
neural crest morphology, abnormal AB + MO1-mych Fig. 6 with image from Hong et al., 2008
neural crest cell decreased amount, abnormal AB + MO1-mych Fig. 6 with image from Hong et al., 2008
neural crest cell fate specification disrupted, abnormal AB + MO1-mych Fig. 6 with image from Hong et al., 2008
neural plate apoptotic, abnormal AB + MO1-mych Fig. 8 with imagetext only from Hong et al., 2008
pericardium edematous, abnormal AB + MO1-mych Fig. 3 with image from Hong et al., 2008
pharyngeal arch 3-7 aplastic, abnormal y1Tg/y1Tg + MO1-mych Fig. 7 with image from Hong et al., 2008
pharyngeal system development disrupted, abnormal AB + MO1-mych Fig. 7 with image from Hong et al., 2008
post-vent region decreased size, abnormal AB + MO1-mych Fig. 3 with image from Hong et al., 2008
retinal neural layer morphology, abnormal AB + MO1-mych Fig. 3 with image from Hong et al., 2008
trunk decreased length, abnormal AB + MO1-mych Fig. 3 with image from Hong et al., 2008
trunk increased width, abnormal AB + MO1-mych Fig. 3 with imageFig. 4 with image from Hong et al., 2008
Phenotype of all Fish created by or utilizing MO1-mych
Phenotype Fish Conditions Figures
pharyngeal system development disrupted, abnormal y1Tg/y1Tg + MO1-mych standard conditions Fig. 7 with image from Hong et al., 2008
pharyngeal arch 3-7 aplastic, abnormal y1Tg/y1Tg + MO1-mych standard conditions Fig. 7 with image from Hong et al., 2008
neural crest cell decreased amount, abnormal AB + MO1-mych standard conditions Fig. 6 with image from Hong et al., 2008
neural plate apoptotic, abnormal AB + MO1-mych standard conditions Fig. 8 with imagetext only from Hong et al., 2008
neural crest morphology, abnormal AB + MO1-mych standard conditions Fig. 6 with image from Hong et al., 2008
pharyngeal system development disrupted, abnormal AB + MO1-mych standard conditions Fig. 7 with image from Hong et al., 2008
neural crest cell fate specification disrupted, abnormal AB + MO1-mych standard conditions Fig. 6 with image from Hong et al., 2008
cranial cartilage aplastic, abnormal AB + MO1-mych standard conditions Fig. 7 with image from Hong et al., 2008
trunk decreased length, abnormal AB + MO1-mych standard conditions Fig. 3 with image from Hong et al., 2008
pericardium edematous, abnormal AB + MO1-mych standard conditions Fig. 3 with image from Hong et al., 2008
neural crest decreased thickness, abnormal AB + MO1-mych standard conditions Fig. 6 with image from Hong et al., 2008
eye decreased size, abnormal AB + MO1-mych standard conditions Fig. 4 with image from Hong et al., 2008
post-vent region decreased size, abnormal AB + MO1-mych standard conditions Fig. 3 with image from Hong et al., 2008
embryonic retina morphogenesis in camera-type eye disrupted, abnormal AB + MO1-mych standard conditions Fig. 3 with image from Hong et al., 2008
retinal neural layer morphology, abnormal AB + MO1-mych standard conditions Fig. 3 with image from Hong et al., 2008
forebrain morphogenesis disrupted, abnormal AB + MO1-mych standard conditions Fig. 5 with image from Hong et al., 2008
pharyngeal arch 3-7 aplastic, abnormal AB + MO1-mych standard conditions Fig. 7 with image from Hong et al., 2008
midbrain increased width, abnormal AB + MO1-mych standard conditions Fig. 4 with image from Hong et al., 2008
trunk increased width, abnormal AB + MO1-mych standard conditions Fig. 3 with imageFig. 4 with image from Hong et al., 2008
endoderm development disrupted, abnormal AB + MO1-mych standard conditions Fig. 7 with image from Hong et al., 2008
mesoderm development disrupted, abnormal AB + MO1-mych standard conditions Fig. 7 with image from Hong et al., 2008
head decreased size, abnormal AB + MO1-mych standard conditions Fig. 3 with image from Hong et al., 2008
hindbrain increased width, abnormal AB + MO1-mych standard conditions Fig. 4 with image from Hong et al., 2008
neural crest cell fate specification disrupted, abnormal AB + MO1-mych + MO2-mych standard conditions Fig. 6 with image from Hong et al., 2008
neural crest decreased thickness, abnormal AB + MO1-mych + MO2-mych standard conditions Fig. 6 with image from Hong et al., 2008
trunk decreased length, abnormal AB + MO1-mych + MO2-mych standard conditions Fig. 3 with image from Hong et al., 2008
head decreased size, abnormal AB + MO1-mych + MO2-mych standard conditions Fig. 3 with image from Hong et al., 2008
neural crest cell decreased amount, abnormal AB + MO1-mych + MO2-mych standard conditions Fig. 6 with image from Hong et al., 2008
Citations