Morpholino

MO2-ndrg4

ID
ZDB-MRPHLNO-080813-2
Name
MO2-ndrg4
Previous Names
None
Target
Sequence
5' - TGCATTCATCTTACCCTTGAGGCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ndrg4
No data available
Phenotype
Phenotype resulting from MO2-ndrg4
Phenotype Fish Figures
atrioventricular canal cardiac muscle cell mislocalised, abnormal WT + MO2-ndrg4 Fig. 8 with image from Qu et al., 2008
atrium decreased size, abnormal WT + MO2-ndrg4 Fig. 6 with image from Qu et al., 2008
atrium dilated, abnormal WT + MO2-ndrg4 Fig. 4 with imageFig. 6 with image from Qu et al., 2008
atrium cardiac muscle cell decreased amount, abnormal f2Tg + MO2-ndrg4 Fig. 6 with image from Qu et al., 2008
atrium extracellular matrix increased size, abnormal WT + MO2-ndrg4 Fig. 6 with image from Qu et al., 2008
blood circulation disrupted, abnormal f1Tg + MO2-ndrg4 Fig. 4 with imageFig. 5 with imageFig. 6 with image from Qu et al., 2008
cardiac muscle cell decreased size, abnormal f1Tg + MO2-ndrg4 Fig. 6 with image from Qu et al., 2008
cardiac muscle cell differentiation disrupted, abnormal WT + MO2-ndrg4 Fig. 8 with image from Qu et al., 2008
cardiac ventricle decreased size, abnormal WT + MO2-ndrg4 Fig. 6 with image from Qu et al., 2008
cardiac ventricle cardiac muscle cell decreased amount, abnormal f2Tg + MO2-ndrg4 Fig. 6 with image from Qu et al., 2008
central nervous system apoptotic, abnormal WT + MO2-ndrg4 text only from Qu et al., 2008
clustering of voltage-gated calcium channels decreased process quality, abnormal vu234Tg + MO2-ndrg4 Fig. S1 with image from Fontenas et al., 2016
eye decreased size, abnormal WT + MO2-ndrg4 Fig. S1 with image from Fontenas et al., 2016
Fig. 4 with image from Qu et al., 2008
head decreased size, abnormal WT + MO2-ndrg4 Fig. S1 with image from Fontenas et al., 2016
heart elongated, abnormal WT + MO2-ndrg4 Fig. 4 with image from Qu et al., 2008
heart contraction amplitude, abnormal WT + MO2-ndrg4 Fig. 4 with image from Qu et al., 2008
heart contraction decreased rate, abnormal WT + MO2-ndrg4 Fig. 4 with image from Qu et al., 2008
heart development disrupted, abnormal WT + MO2-ndrg4 text only from Qu et al., 2008
heart looping disrupted, abnormal WT + MO2-ndrg4 Fig. 4 with imageFig. 5 with image from Qu et al., 2008
heart tube morphology, abnormal WT + MO2-ndrg4 text only from Qu et al., 2008
hindbrain edematous, abnormal WT + MO2-ndrg4 Fig. 4 with image from Qu et al., 2008
locomotion decreased process quality, abnormal WT + MO2-ndrg4 text only from Fontenas et al., 2016
pericardium edematous, abnormal WT + MO2-ndrg4 Fig. 4 with image from Qu et al., 2008
posterior lateral line ganglion neuron Ab3-snap25 labeling decreased distribution, abnormal knu3Tg + MO2-ndrg4 Fig. S1 with image from Fontenas et al., 2016
posterior lateral line nerve axon Ab3-snap25 labeling decreased distribution, abnormal WT + MO2-ndrg4 Fig. 5 with image from Fontenas et al., 2016
posterior lateral line nerve node of Ranvier decreased amount, abnormal WT + MO2-ndrg4 Fig. 2 with imageFig. 6 with image from Fontenas et al., 2016
posterior lateral line nerve synaptic vesicle aggregated, abnormal WT + MO2-ndrg4 Fig. 5 with image from Fontenas et al., 2016
posterior lateral line nerve synaptic vesicle ab-sv2 labeling spatial pattern, abnormal WT + MO2-ndrg4 Fig. 5 with image from Fontenas et al., 2016
thigmotaxis decreased process quality, abnormal WT + MO2-ndrg4 text only from Fontenas et al., 2016
whole organism Ab3-snap25 labeling decreased amount, abnormal WT + MO2-ndrg4 Fig. 5 with image from Fontenas et al., 2016
whole organism decreased width, abnormal WT + MO2-ndrg4 Fig. S1 with image from Fontenas et al., 2016
Phenotype of all Fish created by or utilizing MO2-ndrg4
Phenotype Fish Conditions Figures
heart tube morphology, abnormal WT + MO2-ndrg4 standard conditions text only from Qu et al., 2008
posterior lateral line nerve axon Ab3-snap25 labeling decreased distribution, abnormal WT + MO2-ndrg4 standard conditions Fig. 5 with image from Fontenas et al., 2016
heart contraction decreased rate, abnormal WT + MO2-ndrg4 standard conditions Fig. 4 with image from Qu et al., 2008
atrium dilated, abnormal WT + MO2-ndrg4 standard conditions Fig. 4 with imageFig. 6 with image from Qu et al., 2008
atrium decreased size, abnormal WT + MO2-ndrg4 standard conditions Fig. 6 with image from Qu et al., 2008
heart contraction amplitude, abnormal WT + MO2-ndrg4 standard conditions Fig. 4 with image from Qu et al., 2008
head decreased size, abnormal WT + MO2-ndrg4 standard conditions Fig. S1 with image from Fontenas et al., 2016
posterior lateral line nerve synaptic vesicle aggregated, abnormal WT + MO2-ndrg4 standard conditions Fig. 5 with image from Fontenas et al., 2016
hindbrain edematous, abnormal WT + MO2-ndrg4 standard conditions Fig. 4 with image from Qu et al., 2008
eye decreased size, abnormal WT + MO2-ndrg4 standard conditions Fig. S1 with image from Fontenas et al., 2016
Fig. 4 with image from Qu et al., 2008
posterior lateral line nerve node of Ranvier decreased amount, abnormal WT + MO2-ndrg4 standard conditions Fig. 2 with imageFig. 6 with image from Fontenas et al., 2016
whole organism decreased width, abnormal WT + MO2-ndrg4 standard conditions Fig. S1 with image from Fontenas et al., 2016
atrium extracellular matrix increased size, abnormal WT + MO2-ndrg4 standard conditions Fig. 6 with image from Qu et al., 2008
heart development disrupted, abnormal WT + MO2-ndrg4 standard conditions text only from Qu et al., 2008
cardiac muscle cell differentiation disrupted, abnormal WT + MO2-ndrg4 standard conditions Fig. 8 with image from Qu et al., 2008
blood circulation disrupted, abnormal WT + MO2-ndrg4 standard conditions Fig. 4 with imageFig. 6 with image from Qu et al., 2008
whole organism Ab3-snap25 labeling decreased amount, abnormal WT + MO2-ndrg4 standard conditions Fig. 5 with image from Fontenas et al., 2016
heart elongated, abnormal WT + MO2-ndrg4 standard conditions Fig. 4 with image from Qu et al., 2008
pericardium edematous, abnormal WT + MO2-ndrg4 standard conditions Fig. 4 with image from Qu et al., 2008
central nervous system apoptotic, abnormal WT + MO2-ndrg4 standard conditions text only from Qu et al., 2008
posterior lateral line nerve synaptic vesicle ab-sv2 labeling spatial pattern, abnormal WT + MO2-ndrg4 standard conditions Fig. 5 with image from Fontenas et al., 2016
cardiac ventricle decreased size, abnormal WT + MO2-ndrg4 standard conditions Fig. 6 with image from Qu et al., 2008
thigmotaxis decreased process quality, abnormal WT + MO2-ndrg4 standard conditions text only from Fontenas et al., 2016
atrioventricular canal cardiac muscle cell mislocalised, abnormal WT + MO2-ndrg4 standard conditions Fig. 8 with image from Qu et al., 2008
locomotion decreased process quality, abnormal WT + MO2-ndrg4 standard conditions text only from Fontenas et al., 2016
heart looping disrupted, abnormal WT + MO2-ndrg4 standard conditions Fig. 4 with image from Qu et al., 2008
cardiac muscle cell decreased amount, abnormal f1Tg + MO2-ndrg4 chemical treatment: 5-bromo-2'-deoxyuridine Fig. 7 with image from Qu et al., 2008
cardiac muscle cell decreased size, abnormal f1Tg + MO2-ndrg4 standard conditions Fig. 6 with image from Qu et al., 2008
blood circulation disrupted, abnormal f1Tg + MO2-ndrg4 standard conditions Fig. 5 with image from Qu et al., 2008
cardiac muscle cell proliferation disrupted, abnormal f1Tg + MO2-ndrg4 chemical treatment: 5-bromo-2'-deoxyuridine Fig. 7 with image from Qu et al., 2008
heart looping disrupted, abnormal f1Tg + MO2-ndrg4 standard conditions Fig. 5 with image from Qu et al., 2008
cardiac ventricle cardiac muscle cell decreased amount, abnormal f2Tg + MO2-ndrg4 standard conditions Fig. 6 with image from Qu et al., 2008
atrium cardiac muscle cell decreased amount, abnormal f2Tg + MO2-ndrg4 standard conditions Fig. 6 with image from Qu et al., 2008
posterior lateral line ganglion neuron Ab3-snap25 labeling decreased distribution, abnormal knu3Tg + MO2-ndrg4 control Fig. S1 with image from Fontenas et al., 2016
clustering of voltage-gated calcium channels decreased process quality, abnormal vu234Tg + MO2-ndrg4 standard conditions Fig. S1 with image from Fontenas et al., 2016
Citations