header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-071107-1
Morpholino Name: MO2-wt1a
Target: wt1a (1)
Previous Name: wt1a-splice1-1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AAAGTAGTTCCTCACCTTGATTCCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-wt1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-wt1a
Expressed Gene Anatomy Figures
mafba Fig. 5 from Dong et al., 2015
magi2a Fig. 5 from Dong et al., 2015
nphs1 Fig. 4 with image from Schnerwitzki et al., 2014
Fig. 4 with image from Perner et al., 2007
nphs2 Fig. 5 from Dong et al., 2015
Fig. 4 with image from Perner et al., 2007
PHENOTYPE
Phenotype resulting from MO2-wt1a
Phenotype of all Fish created by or utilizing MO2-wt1a
Phenotype Fish Conditions Figures
pericardium edematous, abnormal AB/TU + MO2-wt1a standard conditions Fig. 1 with image from Perner et al., 2007
yolk edematous, abnormal AB/TU + MO2-wt1a standard conditions Fig. 1 with imageFig. S2 with image from Perner et al., 2007
whole organism edematous, abnormal AB/TU + MO2-wt1a standard conditions Fig. 1 with image from Perner et al., 2007
yolk syncytial layer edematous, abnormal EKW + MO2-wt1a standard conditions Fig. 3 from Hall et al., 2015
podocyte podocyte foot morphology, abnormal EKW + MO2-wt1a standard conditions Fig. 4 from Hall et al., 2015
glomerular filtration disrupted, abnormal EKW + MO2-wt1a standard conditions Fig. 3 from Hall et al., 2015
pericardium edematous, abnormal EKW + MO2-wt1a standard conditions Fig. 3 from Hall et al., 2015
podocyte podocyte foot flattened, abnormal EKW + MO2-wt1a standard conditions Fig. 4 from Hall et al., 2015
glomerular visceral epithelial cell differentiation disrupted, abnormal EKW + MO2-wt1a standard conditions Fig. 4 from Hall et al., 2015
pronephric glomerulus aplastic, abnormal li1Tg + MO2-wt1a(AB/TU) standard conditions Fig. 3 with image from Perner et al., 2007
pronephros development disrupted, abnormal li1Tg + MO2-wt1a standard conditions Fig. 4 with image from Perner et al., 2016
somite EGFP expression spatial pattern, abnormal li1Tg + MO2-wt1a standard conditions Fig. 4 with image from Perner et al., 2016
presumptive pronephric mesoderm malformed, abnormal li1Tg + MO2-wt1a standard conditions Fig. 4 with image from Schnerwitzki et al., 2014
pronephric tubule aplastic, abnormal li1Tg + MO2-wt1a(AB/TU) standard conditions Fig. 3 with image from Perner et al., 2007
pronephric glomerulus morphogenesis arrested, abnormal li1Tg + MO2-wt1a standard conditions Fig. 4 with image from Schnerwitzki et al., 2014
glomerulus development disrupted, abnormal li1Tg + MO2-wt1a(AB/TU) standard conditions Fig. 3 with image from Perner et al., 2007
somite EGFP expression mislocalised, abnormal li1Tg + MO2-wt1a standard conditions Fig. 4 with image from Perner et al., 2016
glomerulus development disrupted, abnormal li1Tg + MO2-wt1a standard conditions Fig. 4 with image from Schnerwitzki et al., 2014
yolk edematous, abnormal AB/TU + MO1-wt1b + MO2-wt1a standard conditions Fig. S2 with image from Perner et al., 2007
whole organism increased curvature, abnormal AB/TU + MO1-wt1b + MO2-wt1a standard conditions Fig. S2 with image from Perner et al., 2007
pronephric tubule aplastic, abnormal li1Tg + MO1-wt1b + MO2-wt1a(AB/TU) standard conditions Fig. 3 with image from Perner et al., 2007
glomerulus development disrupted, abnormal li1Tg + MO1-wt1b + MO2-wt1a(AB/TU) standard conditions Fig. 3 with image from Perner et al., 2007
pronephros development disrupted, abnormal li1Tg + MO1-wt1b + MO2-wt1a(AB/TU) standard conditions Fig. 3 with image from Perner et al., 2007
pronephric glomerulus aplastic, abnormal li1Tg + MO1-wt1b + MO2-wt1a(AB/TU) standard conditions Fig. 3 with image from Perner et al., 2007
pronephric duct malformed, abnormal li1Tg + MO1-wt1b + MO2-wt1a(AB/TU) standard conditions Fig. 3 with image from Perner et al., 2007
Genome Resources:
CITATIONS (5)