Morpholino
MO2-wt1a
- ID
- ZDB-MRPHLNO-071107-1
- Name
- MO2-wt1a
- Previous Names
-
- wt1a-splice1-1 (1)
- Target
- Sequence
-
5' - AAAGTAGTTCCTCACCTTGATTCCT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-wt1a
Expressed Gene | Anatomy | Figures |
---|---|---|
mafba |
|
Fig. 5
from Dong et al., 2015 |
magi2a |
|
Fig. 5
from Dong et al., 2015 |
nphs1 |
|
Fig. 4 ![]() Fig. 4 ![]() |
nphs2 |
|
Fig. 5
from Dong et al., 2015 Fig. 4 ![]() |
1 - 4 of 4
Phenotype
Phenotype resulting from MO2-wt1a
1 - 5 of 19 Show all
Phenotype of all Fish created by or utilizing MO2-wt1a
1 - 5 of 28 Show all
Citations
- Pollitt, E.J.G., Sánchez-Posada, J., Snashall, C.M., Derrick, C.J., Noël, E.S. (2024) Llgl1 mediates timely epicardial emergence and establishment of an apical laminin sheath around the trabeculating cardiac ventricle. Development (Cambridge, England). 151(13):
- Hopfenmüller, V.L., Perner, B., Reuter, H., Bates, T.J.D., Große, A., Englert, C. (2022) The Wilms Tumor Gene wt1a Contributes to Blood-Cerebrospinal Fluid Barrier Function in Zebrafish. Frontiers in cell and developmental biology. 9:809962
- Perner, B., Schnerwitzki, D., Graf, M., Englert, C. (2016) Analysis of Zebrafish Kidney Development with Time-lapse Imaging Using a Dissecting Microscope Equipped for Optical Sectioning. Journal of visualized experiments : JoVE. (110):e53921
- Dong, L., Pietsch, S., Tan, Z., Perner, B., Sierig, R., Kruspe, D., Groth, M., Witzgall, R., Gröne, H., Platzer, M., Englert, C. (2015) Integration of Cistromic and Transcriptomic Analyses Identifies Nphs2, Mafb, and Magi2 as Wilms' Tumor 1 Target Genes in Podocyte Differentiation and Maintenance. Journal of the American Society of Nephrology : JASN. 26(9):2118-28
- Hall, G., Gbadegesin, R.A., Lavin, P., Wu, G., Liu, Y., Oh, E.C., Wang, L., Spurney, R.F., Eckel, J., Lindsey, T., Homstad, A., Malone, A.F., Phelan, P.J., Shaw, A., Howell, D.N., Conlon, P.J., Katsanis, N., Winn, M.P. (2015) A Novel Missense Mutation of Wilms' Tumor 1 Causes Autosomal Dominant FSGS. Journal of the American Society of Nephrology : JASN. 26(4):831-43
- Schnerwitzki, D., Perner, B., Hoppe, B., Pietsch, S., Mehringer, R., Hänel, F., Englert, C. (2014) Alternative splicing of Wilms tumor suppressor 1 (Wt1) exon 4 results in protein isoforms with different functions. Developmental Biology. 393(1):24-32
- Perner, B., Englert, C., and Bollig, F. (2007) The Wilms tumor genes wt1a and wt1b control different steps during formation of the zebrafish pronephros. Developmental Biology. 309(1):87-96
1 - 7 of 7
Show