Morpholino

MO2-wt1a

ID
ZDB-MRPHLNO-071107-1
Name
MO2-wt1a
Previous Names
  • wt1a-splice1-1 (1)
Target
Sequence
5' - AAAGTAGTTCCTCACCTTGATTCCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-wt1a
Phenotype
Phenotype resulting from MO2-wt1a
Phenotype Fish Figures
glomerular filtration disrupted, abnormal EKW + MO2-wt1a Fig. 3 from Hall et al., 2015
glomerulus development disrupted, abnormal li1Tg + MO2-wt1a Fig. 4 with image from Schnerwitzki et al., 2014
Fig. 3 with image from Perner et al., 2007
pericardium edematous, abnormal AB/TU + MO2-wt1a Fig. 3 from Hall et al., 2015
Fig. 1 with image from Perner et al., 2007
podocyte podocyte foot flattened, abnormal EKW + MO2-wt1a Fig. 4 from Hall et al., 2015
podocyte podocyte foot morphology, abnormal EKW + MO2-wt1a Fig. 4 from Hall et al., 2015
podocyte differentiation disrupted, abnormal EKW + MO2-wt1a Fig. 4 from Hall et al., 2015
presumptive pronephric mesoderm malformed, abnormal li1Tg + MO2-wt1a Fig. 4 with image from Schnerwitzki et al., 2014
pronephric glomerulus aplastic, abnormal li1Tg + MO2-wt1a (AB/TU) Fig. 3 with image from Perner et al., 2007
pronephric glomerulus morphogenesis arrested, abnormal li1Tg + MO2-wt1a Fig. 4 with image from Schnerwitzki et al., 2014
pronephric tubule aplastic, abnormal li1Tg + MO2-wt1a (AB/TU) Fig. 3 with image from Perner et al., 2007
pronephros development disrupted, abnormal li1Tg + MO2-wt1a Fig. 4 with image from Perner et al., 2016
somite EGFP expression mislocalised, abnormal li1Tg + MO2-wt1a Fig. 4 with image from Perner et al., 2016
somite EGFP expression spatial pattern, abnormal li1Tg + MO2-wt1a Fig. 4 with image from Perner et al., 2016
whole organism edematous, abnormal AB/TU + MO2-wt1a Fig. 1 with image from Perner et al., 2007
yolk edematous, abnormal AB/TU + MO2-wt1a Fig. 1 with imageFig. S2 with image from Perner et al., 2007
yolk syncytial layer edematous, abnormal EKW + MO2-wt1a Fig. 3 from Hall et al., 2015
Phenotype of all Fish created by or utilizing MO2-wt1a
Phenotype Fish Conditions Figures
pericardium edematous, abnormal AB/TU + MO2-wt1a standard conditions Fig. 1 with image from Perner et al., 2007
yolk edematous, abnormal AB/TU + MO2-wt1a standard conditions Fig. 1 with imageFig. S2 with image from Perner et al., 2007
whole organism edematous, abnormal AB/TU + MO2-wt1a standard conditions Fig. 1 with image from Perner et al., 2007
yolk syncytial layer edematous, abnormal EKW + MO2-wt1a standard conditions Fig. 3 from Hall et al., 2015
podocyte podocyte foot morphology, abnormal EKW + MO2-wt1a standard conditions Fig. 4 from Hall et al., 2015
glomerular filtration disrupted, abnormal EKW + MO2-wt1a standard conditions Fig. 3 from Hall et al., 2015
podocyte differentiation disrupted, abnormal EKW + MO2-wt1a standard conditions Fig. 4 from Hall et al., 2015
pericardium edematous, abnormal EKW + MO2-wt1a standard conditions Fig. 3 from Hall et al., 2015
podocyte podocyte foot flattened, abnormal EKW + MO2-wt1a standard conditions Fig. 4 from Hall et al., 2015
pronephros development disrupted, abnormal li1Tg + MO2-wt1a standard conditions Fig. 4 with image from Perner et al., 2016
somite EGFP expression spatial pattern, abnormal li1Tg + MO2-wt1a standard conditions Fig. 4 with image from Perner et al., 2016
presumptive pronephric mesoderm malformed, abnormal li1Tg + MO2-wt1a standard conditions Fig. 4 with image from Schnerwitzki et al., 2014
pronephric glomerulus morphogenesis arrested, abnormal li1Tg + MO2-wt1a standard conditions Fig. 4 with image from Schnerwitzki et al., 2014
somite EGFP expression mislocalised, abnormal li1Tg + MO2-wt1a standard conditions Fig. 4 with image from Perner et al., 2016
glomerulus development disrupted, abnormal li1Tg + MO2-wt1a standard conditions Fig. 4 with image from Schnerwitzki et al., 2014
pronephric glomerulus aplastic, abnormal li1Tg + MO2-wt1a (AB/TU) standard conditions Fig. 3 with image from Perner et al., 2007
pronephric tubule aplastic, abnormal li1Tg + MO2-wt1a (AB/TU) standard conditions Fig. 3 with image from Perner et al., 2007
glomerulus development disrupted, abnormal li1Tg + MO2-wt1a (AB/TU) standard conditions Fig. 3 with image from Perner et al., 2007
yolk edematous, abnormal AB/TU + MO1-wt1b + MO2-wt1a standard conditions Fig. S2 with image from Perner et al., 2007
whole organism increased curvature, abnormal AB/TU + MO1-wt1b + MO2-wt1a standard conditions Fig. S2 with image from Perner et al., 2007
pronephric tubule aplastic, abnormal li1Tg + MO1-wt1b + MO2-wt1a (AB/TU) standard conditions Fig. 3 with image from Perner et al., 2007
glomerulus development disrupted, abnormal li1Tg + MO1-wt1b + MO2-wt1a (AB/TU) standard conditions Fig. 3 with image from Perner et al., 2007
pronephros development disrupted, abnormal li1Tg + MO1-wt1b + MO2-wt1a (AB/TU) standard conditions Fig. 3 with image from Perner et al., 2007
pronephric glomerulus aplastic, abnormal li1Tg + MO1-wt1b + MO2-wt1a (AB/TU) standard conditions Fig. 3 with image from Perner et al., 2007
pronephric duct malformed, abnormal li1Tg + MO1-wt1b + MO2-wt1a (AB/TU) standard conditions Fig. 3 with image from Perner et al., 2007
Citations