Morpholino
MO9-pkd2
- ID
- ZDB-MRPHLNO-070620-5
- Name
- MO9-pkd2
- Previous Names
-
- cup augMO (1)
- Target
- Sequence
-
5' - AGCTCATCGTGTATTTCTACAGTAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO9-pkd2
No data available
Phenotype
Phenotype resulting from MO9-pkd2
1 - 5 of 10 Show all
Phenotype of all Fish created by or utilizing MO9-pkd2
1 - 5 of 31 Show all
Citations
- Oliveira, I., Jacinto, R., Pestana, S., Nolasco, F., Calado, J., Lopes, S.S., Roxo-Rosa, M. (2021) Zebrafish Model as a Screen to Prevent Cyst Inflation in Autosomal Dominant Polycystic Kidney Disease. International Journal of Molecular Sciences. 22(16):
- Roxo-Rosa, M., Jacinto, R., Sampaio, P., Lopes, S.S. (2015) The zebrafish Kupffer's vesicle as a model system for the molecular mechanisms by which the lack of Polycystin-2 leads to stimulation of CFTR. Biology Open. 4(11):1356-66
- Schottenfeld, J., Sullivan-Brown, J., and Burdine, R.D. (2007) Zebrafish curly up encodes a Pkd2 ortholog that restricts left-side-specific expression of southpaw. Development (Cambridge, England). 134(8):1605-1615
1 - 3 of 3
Show