Morpholino

MO2-dll4

ID
ZDB-MRPHLNO-070509-2
Name
MO2-dll4
Previous Names
None
Target
Sequence
5' - CGAATCTTACCTACAGGTAGATCCG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice blocking morpholino.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-dll4
No data available
Phenotype
Phenotype resulting from MO2-dll4
Phenotype of all Fish created by or utilizing MO2-dll4
Phenotype Fish Conditions Figures
intersegmental vessel has extra parts of type endothelial cell, abnormal WT + MO2-dll4 standard conditions Fig. 3 with image from Villefranc et al., 2013
intersegmental vessel increased branchiness, abnormal WT + MO2-dll4 standard conditions Fig. 3 with image from Villefranc et al., 2013
angiogenesis disrupted, abnormal WT + MO2-dll4 standard conditions Fig. 3 with image from Villefranc et al., 2013
intersegmental vessel branchiness, ameliorated la116Tg + MO2-dll4 chemical treatment by environment: SL-327 Fig. S5 with image from Shin et al., 2016
basal communicating artery increased size, abnormal la116Tg + MO2-dll4 standard conditions Fig. 4 from Rochon et al., 2015
intersegmental vessel increased branchiness, abnormal la116Tg + MO2-dll4 control Fig. S5 with image from Shin et al., 2016
VeLD increased amount, abnormal nns5Tg + MO2-dll4 standard conditions Fig. 3 with image from Okigawa et al., 2014
CiD increased amount, abnormal nns5Tg + MO2-dll4 standard conditions Fig. 3 with image from Okigawa et al., 2014
intersegmental artery blood vessel endothelial cell increased amount, abnormal y7Tg + MO2-dll4 standard conditions Fig. S7 from Siekmann et al., 2007
CiD increased amount, abnormal nns5Tg + MO2-dll4 + MO4-dla standard conditions Fig. 3 with image from Okigawa et al., 2014
VeLD increased amount, abnormal nns5Tg + MO2-dll4 + MO4-dla standard conditions Fig. 3 with image from Okigawa et al., 2014
sprouting angiogenesis increased occurrence, abnormal s916Tg + MO2-dll4 standard conditions Fig. 2 with image from Bussmann et al., 2011
central artery increased amount, abnormal s916Tg + MO2-dll4 standard conditions Fig. 2 with image from Bussmann et al., 2011
cranial blood vessel artery morphogenesis process quality, abnormal acvrl1y6/y6; la116Tg + MO2-dll4 standard conditions Fig. 4 from Rochon et al., 2015
basal communicating artery increased size, abnormal acvrl1y6/y6; la116Tg + MO2-dll4 standard conditions Fig. 4 from Rochon et al., 2015
intersegmental vessel nucleus increased amount, abnormal s916Tg; y7Tg + MO2-dll4 standard conditions Fig. 5 with image from Nicoli et al., 2012
intersegmental vessel has extra parts of type endothelial cell, abnormal vegfcum18/+; y1Tg + MO2-dll4 standard conditions Fig. 3 with image from Villefranc et al., 2013
intersegmental vessel increased branchiness, abnormal vegfcum18/+; y1Tg + MO2-dll4 standard conditions Fig. 3 with image from Villefranc et al., 2013
angiogenesis disrupted, abnormal vegfcum18/um18; y1Tg/y1Tg + MO2-dll4 standard conditions Fig. 3 with image from Villefranc et al., 2013
intersegmental vessel increased branchiness, abnormal vegfcum18/um18; y1Tg/y1Tg + MO2-dll4 standard conditions Fig. 3 with image from Villefranc et al., 2013
intersegmental vessel decreased length, abnormal s916Tg; y7Tg + MO1-dre-mir-221 + MO2-dll4 standard conditions Fig. 5 with image from Nicoli et al., 2012
intersegmental vessel nucleus decreased amount, abnormal s916Tg; y7Tg + MO1-dre-mir-221 + MO2-dll4 standard conditions Fig. 5 with image from Nicoli et al., 2012
Citations