header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060302-4
Morpholino Name: MO2-ptger4a
Target: ptger4a (1)
Previous Names: ep4-MO2 (1), MO2-ptger4l

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CACGGTGGGCTCCATGCTGCTGCTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: translation blocker targeted to start codon
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-ptger4a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-ptger4a
Expressed Gene Anatomy Figures
bmp4 Fig. 3 with image from Cha et al., 2006
foxn1 Fig. 4 from Villablanca et al., 2007
gsc Fig. 3 with image from Cha et al., 2006
ikzf1 Fig. 5 from Villablanca et al., 2007
myl7 Fig. 5 from Jin et al., 2014
pax2a Fig. 3 with image from Cha et al., 2006
rag1 Fig. T1 from Villablanca et al., 2007
six3b Fig. 3 with image from Cha et al., 2006
slc12a1 Fig. 4 with image from Poureetezadi et al., 2016
slc12a3 Fig. 4 with image from Poureetezadi et al., 2016
tbxta Fig. 3 with image from Cha et al., 2006
PHENOTYPE
Phenotype resulting from MO2-ptger4a
Phenotype Figures
axis decreased length, abnormal Fig. 3 with image from Cha et al., 2006
brain hydrocephalic, abnormal Fig. 5 from Jin et al., 2014
brain ventricular system edematous, abnormal Fig. 5 from Jin et al., 2014
cilium assembly decreased process quality, abnormal Fig. 5 from Jin et al., 2014
convergent extension involved in gastrulation delayed, abnormal Fig. 3 with image from Cha et al., 2006
convergent extension involved in gastrulation disrupted, abnormal Fig. 3 with image from Cha et al., 2006
epiboly involved in gastrulation with mouth forming second delayed, abnormal Fig. 3 with image from Cha et al., 2006
head position, abnormal Fig. 3 with image from Cha et al., 2006
heart bilateral symmetry, abnormal Fig. 5 from Jin et al., 2014
heart looping process quality, abnormal Fig. 5 from Jin et al., 2014
hemopoiesis disrupted, abnormal Fig. 5 from Villablanca et al., 2007
Kupffer's vesicle has fewer parts of type Kupffer's vesicle motile cilium, abnormal Fig. 5 from Jin et al., 2014
Kupffer's vesicle motile cilium decreased length, abnormal Fig. 5 from Jin et al., 2014
lateral crista has fewer parts of type lateral crista kinocilium, abnormal Fig. 5 from Jin et al., 2014
notochord increased width, abnormal Fig. 3 with image from Cha et al., 2006
notochord undulate, abnormal Fig. 3 with image from Cha et al., 2006
otic vesicle has extra parts of type otolith, abnormal Fig. 5 from Jin et al., 2014
post-vent region curved ventral, abnormal Fig. 5 from Jin et al., 2014
pronephric distal early tubule slc12a1 expression increased distribution, abnormal Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal early tubule increased size, abnormal Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal late tubule decreased size, abnormal Fig. 4 with image from Poureetezadi et al., 2016
somite elongated, abnormal Fig. 3 with image from Cha et al., 2006
trunk curved ventral, abnormal Fig. 5 from Jin et al., 2014
ventral wall of dorsal aorta morphology, abnormal Fig. 5 from Villablanca et al., 2007
whole organism anterior-posterior axis decreased length, abnormal Fig. 3 with image from Cha et al., 2006

Phenotype of all Fish created by or utilizing MO2-ptger4a
Phenotype Fish Conditions Figures
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO2-ptger4a standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal late tubule decreased size, abnormal TU + MO2-ptger4a standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal early tubule slc12a1 expression increased distribution, abnormal TU + MO2-ptger4a standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal early tubule increased size, abnormal TU + MO2-ptger4a standard conditions Fig. 4 with image from Poureetezadi et al., 2016
exocrine pancreas prss1 expression amount, ameliorated WT + MO1-ptger4a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
exocrine pancreas prss1 expression decreased distribution, abnormal WT + MO1-ptger4a + MO2-ptger4a control Fig. 2 with image from Nissim et al., 2014
exocrine pancreas size, ameliorated WT + MO1-ptger4a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
hematopoietic stem cell decreased amount, abnormal WT + MO1-ptger4a + MO2-ptger4a standard conditions Fig. S1 from North et al., 2007
exocrine pancreas decreased size, abnormal WT + MO1-ptger4a + MO2-ptger4a control Fig. 2 with image from Nissim et al., 2014
Kupffer's vesicle motile cilium decreased length, abnormal WT + MO2-ptger4a chemical treatment: forskolin Fig. 5 from Jin et al., 2014
trunk curved ventral, abnormal WT + MO2-ptger4a standard conditions Fig. 5 from Jin et al., 2014
brain ventricular system edematous, abnormal WT + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 5 from Jin et al., 2014
Kupffer's vesicle motile cilium decreased length, abnormal WT + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 5 from Jin et al., 2014
cilium assembly decreased process quality, abnormal WT + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 5 from Jin et al., 2014
Kupffer's vesicle has fewer parts of type Kupffer's vesicle motile cilium, abnormal WT + MO2-ptger4a chemical treatment: forskolin Fig. 5 from Jin et al., 2014
somite elongated, abnormal WT + MO2-ptger4a standard conditions Fig. 3 with image from Cha et al., 2006
whole organism anterior-posterior axis decreased length, abnormal WT + MO2-ptger4a standard conditions Fig. 3 with image from Cha et al., 2006
Kupffer's vesicle has fewer parts of type Kupffer's vesicle motile cilium, abnormal WT + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 5 from Jin et al., 2014
epiboly involved in gastrulation with mouth forming second delayed, abnormal WT + MO2-ptger4a standard conditions Fig. 3 with image from Cha et al., 2006
heart bilateral symmetry, abnormal WT + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 5 from Jin et al., 2014
heart looping process quality, abnormal WT + MO2-ptger4a standard conditions Fig. 5 from Jin et al., 2014
cilium assembly decreased process quality, abnormal WT + MO2-ptger4a standard conditions Fig. 5 from Jin et al., 2014
heart bilateral symmetry, abnormal WT + MO2-ptger4a standard conditions Fig. 5 from Jin et al., 2014
head position, abnormal WT + MO2-ptger4a standard conditions Fig. 3 with image from Cha et al., 2006
axis decreased length, abnormal WT + MO2-ptger4a standard conditions Fig. 3 with image from Cha et al., 2006
Kupffer's vesicle motile cilium decreased length, abnormal WT + MO2-ptger4a standard conditions Fig. 5 from Jin et al., 2014
post-vent region curved ventral, abnormal WT + MO2-ptger4a standard conditions Fig. 5 from Jin et al., 2014
ventral wall of dorsal aorta morphology, abnormal WT + MO2-ptger4a standard conditions Fig. 5 from Villablanca et al., 2007
heart looping process quality, abnormal WT + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 5 from Jin et al., 2014
hemopoiesis disrupted, abnormal WT + MO2-ptger4a standard conditions Fig. 5 from Villablanca et al., 2007
convergent extension involved in gastrulation disrupted, abnormal WT + MO2-ptger4a standard conditions Fig. 3 with image from Cha et al., 2006
brain hydrocephalic, abnormal WT + MO2-ptger4a standard conditions Fig. 5 from Jin et al., 2014
brain ventricular system edematous, abnormal WT + MO2-ptger4a standard conditions Fig. 5 from Jin et al., 2014
Kupffer's vesicle has fewer parts of type Kupffer's vesicle motile cilium, abnormal WT + MO2-ptger4a standard conditions Fig. 5 from Jin et al., 2014
notochord increased width, abnormal WT + MO2-ptger4a standard conditions Fig. 3 with image from Cha et al., 2006
convergent extension involved in gastrulation delayed, abnormal WT + MO2-ptger4a standard conditions Fig. 3 with image from Cha et al., 2006
otic vesicle has extra parts of type otolith, abnormal WT + MO2-ptger4a standard conditions Fig. 5 from Jin et al., 2014
notochord undulate, abnormal WT + MO2-ptger4a standard conditions Fig. 3 with image from Cha et al., 2006
lateral crista has fewer parts of type lateral crista kinocilium, abnormal WT + MO2-ptger4a standard conditions Fig. 5 from Jin et al., 2014
liver EGFP expression decreased distribution, abnormal as3Tg + MO1-ptger4a + MO2-ptger4a control Fig. 1 with image from Nissim et al., 2014
liver EGFP expression amount, ameliorated as3Tg + MO1-ptger4a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 1 with image from Nissim et al., 2014
liver decreased size, abnormal as3Tg + MO1-ptger4a + MO2-ptger4a control Fig. 1 with image from Nissim et al., 2014
liver size, ameliorated as3Tg + MO1-ptger4a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 1 with image from Nissim et al., 2014
exocrine pancreas decreased size, abnormal zf578Tg + MO1-ptger4a + MO2-ptger4a control Fig. 2 with image from Nissim et al., 2014
exocrine pancreas size, ameliorated zf578Tg + MO1-ptger4a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
exocrine pancreas decreased size, abnormal WT + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
exocrine pancreas decreased size, abnormal WT + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a control Fig. 2 with image from Nissim et al., 2014
exocrine pancreas prss1 expression decreased distribution, abnormal WT + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a control Fig. 2 with image from Nissim et al., 2014
exocrine pancreas prss1 expression amount, ameliorated WT + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
liver decreased size, abnormal as3Tg + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 1 with image from Nissim et al., 2014
liver decreased size, abnormal as3Tg + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a control Fig. 1 with image from Nissim et al., 2014
exocrine pancreas decreased size, abnormal zf578Tg + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
exocrine pancreas decreased size, abnormal zf578Tg + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a control Fig. 2 with image from Nissim et al., 2014
OTHER MO2-ptger4a MORPHOLINO PAGES No links to external sites
CITATIONS (7)