Morpholino

MO2-ptger4a

ID
ZDB-MRPHLNO-060302-4
Name
MO2-ptger4a
Previous Names
  • ep4-MO2 (1)
  • MO2-ptger4l
Target
Sequence
5' - CACGGTGGGCTCCATGCTGCTGCTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
translation blocker targeted to start codon
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ptger4a
Expressed Gene Anatomy Figures
bmp4 Fig. 3 with image from Cha et al., 2006
foxn1 Fig. 4 from Villablanca et al., 2007
gsc Fig. 3 with image from Cha et al., 2006
ikzf1 Fig. 5 from Villablanca et al., 2007
myl7 Fig. 5 from Jin et al., 2014
pax2a Fig. 3 with image from Cha et al., 2006
rag1 Fig. T1 from Villablanca et al., 2007
six3b Fig. 3 with image from Cha et al., 2006
slc12a1 Fig. 4 with image from Poureetezadi et al., 2016
slc12a3 Fig. 4 with image from Poureetezadi et al., 2016
tbxta Fig. 3 with image from Cha et al., 2006
Phenotype
Phenotype resulting from MO2-ptger4a
Phenotype Fish Figures
axis decreased length, abnormal WT + MO2-ptger4a Fig. 3 with image from Cha et al., 2006
brain hydrocephalic, abnormal WT + MO2-ptger4a Fig. 5 from Jin et al., 2014
brain ventricular system edematous, abnormal WT + MO2-ptger4a Fig. 5 from Jin et al., 2014
cilium assembly decreased process quality, abnormal WT + MO2-ptger4a Fig. 5 from Jin et al., 2014
convergent extension involved in gastrulation delayed, abnormal WT + MO2-ptger4a Fig. 3 with image from Cha et al., 2006
convergent extension involved in gastrulation disrupted, abnormal WT + MO2-ptger4a Fig. 3 with image from Cha et al., 2006
epiboly involved in gastrulation with mouth forming second delayed, abnormal WT + MO2-ptger4a Fig. 3 with image from Cha et al., 2006
head position, abnormal WT + MO2-ptger4a Fig. 3 with image from Cha et al., 2006
heart bilateral symmetry, abnormal WT + MO2-ptger4a Fig. 5 from Jin et al., 2014
heart looping process quality, abnormal WT + MO2-ptger4a Fig. 5 from Jin et al., 2014
hemopoiesis disrupted, abnormal WT + MO2-ptger4a Fig. 5 from Villablanca et al., 2007
Kupffer's vesicle has fewer parts of type Kupffer's vesicle motile cilium, abnormal WT + MO2-ptger4a Fig. 5 from Jin et al., 2014
Kupffer's vesicle motile cilium decreased length, abnormal WT + MO2-ptger4a Fig. 5 from Jin et al., 2014
lateral crista has fewer parts of type lateral crista kinocilium, abnormal WT + MO2-ptger4a Fig. 5 from Jin et al., 2014
notochord increased width, abnormal WT + MO2-ptger4a Fig. 3 with image from Cha et al., 2006
notochord undulate, abnormal WT + MO2-ptger4a Fig. 3 with image from Cha et al., 2006
otic vesicle has extra parts of type otolith, abnormal WT + MO2-ptger4a Fig. 5 from Jin et al., 2014
post-vent region curved ventral, abnormal WT + MO2-ptger4a Fig. 5 from Jin et al., 2014
pronephric distal early tubule slc12a1 expression increased distribution, abnormal TU + MO2-ptger4a Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal early tubule increased size, abnormal TU + MO2-ptger4a Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO2-ptger4a Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal late tubule decreased size, abnormal TU + MO2-ptger4a Fig. 4 with image from Poureetezadi et al., 2016
somite elongated, abnormal WT + MO2-ptger4a Fig. 3 with image from Cha et al., 2006
trunk curved ventral, abnormal WT + MO2-ptger4a Fig. 5 from Jin et al., 2014
ventral wall of dorsal aorta morphology, abnormal WT + MO2-ptger4a Fig. 5 from Villablanca et al., 2007
whole organism anterior-posterior axis decreased length, abnormal WT + MO2-ptger4a Fig. 3 with image from Cha et al., 2006
Phenotype of all Fish created by or utilizing MO2-ptger4a
Phenotype Fish Conditions Figures
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO2-ptger4a standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal late tubule decreased size, abnormal TU + MO2-ptger4a standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal early tubule slc12a1 expression increased distribution, abnormal TU + MO2-ptger4a standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal early tubule increased size, abnormal TU + MO2-ptger4a standard conditions Fig. 4 with image from Poureetezadi et al., 2016
exocrine pancreas prss1 expression amount, ameliorated WT + MO1-ptger4a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
exocrine pancreas prss1 expression decreased distribution, abnormal WT + MO1-ptger4a + MO2-ptger4a control Fig. 2 with image from Nissim et al., 2014
exocrine pancreas size, ameliorated WT + MO1-ptger4a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
hematopoietic stem cell decreased amount, abnormal WT + MO1-ptger4a + MO2-ptger4a standard conditions Fig. S1 from North et al., 2007
exocrine pancreas decreased size, abnormal WT + MO1-ptger4a + MO2-ptger4a control Fig. 2 with image from Nissim et al., 2014
Kupffer's vesicle motile cilium decreased length, abnormal WT + MO2-ptger4a chemical treatment: forskolin Fig. 5 from Jin et al., 2014
trunk curved ventral, abnormal WT + MO2-ptger4a standard conditions Fig. 5 from Jin et al., 2014
brain ventricular system edematous, abnormal WT + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 5 from Jin et al., 2014
Kupffer's vesicle motile cilium decreased length, abnormal WT + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 5 from Jin et al., 2014
Kupffer's vesicle has fewer parts of type Kupffer's vesicle motile cilium, abnormal WT + MO2-ptger4a chemical treatment: forskolin Fig. 5 from Jin et al., 2014
cilium assembly decreased process quality, abnormal WT + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 5 from Jin et al., 2014
somite elongated, abnormal WT + MO2-ptger4a standard conditions Fig. 3 with image from Cha et al., 2006
whole organism anterior-posterior axis decreased length, abnormal WT + MO2-ptger4a standard conditions Fig. 3 with image from Cha et al., 2006
Kupffer's vesicle has fewer parts of type Kupffer's vesicle motile cilium, abnormal WT + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 5 from Jin et al., 2014
epiboly involved in gastrulation with mouth forming second delayed, abnormal WT + MO2-ptger4a standard conditions Fig. 3 with image from Cha et al., 2006
heart bilateral symmetry, abnormal WT + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 5 from Jin et al., 2014
heart looping process quality, abnormal WT + MO2-ptger4a standard conditions Fig. 5 from Jin et al., 2014
cilium assembly decreased process quality, abnormal WT + MO2-ptger4a standard conditions Fig. 5 from Jin et al., 2014
heart bilateral symmetry, abnormal WT + MO2-ptger4a standard conditions Fig. 5 from Jin et al., 2014
head position, abnormal WT + MO2-ptger4a standard conditions Fig. 3 with image from Cha et al., 2006
axis decreased length, abnormal WT + MO2-ptger4a standard conditions Fig. 3 with image from Cha et al., 2006
Kupffer's vesicle motile cilium decreased length, abnormal WT + MO2-ptger4a standard conditions Fig. 5 from Jin et al., 2014
post-vent region curved ventral, abnormal WT + MO2-ptger4a standard conditions Fig. 5 from Jin et al., 2014
ventral wall of dorsal aorta morphology, abnormal WT + MO2-ptger4a standard conditions Fig. 5 from Villablanca et al., 2007
heart looping process quality, abnormal WT + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 5 from Jin et al., 2014
hemopoiesis disrupted, abnormal WT + MO2-ptger4a standard conditions Fig. 5 from Villablanca et al., 2007
convergent extension involved in gastrulation disrupted, abnormal WT + MO2-ptger4a standard conditions Fig. 3 with image from Cha et al., 2006
brain ventricular system edematous, abnormal WT + MO2-ptger4a standard conditions Fig. 5 from Jin et al., 2014
brain hydrocephalic, abnormal WT + MO2-ptger4a standard conditions Fig. 5 from Jin et al., 2014
Kupffer's vesicle has fewer parts of type Kupffer's vesicle motile cilium, abnormal WT + MO2-ptger4a standard conditions Fig. 5 from Jin et al., 2014
notochord increased width, abnormal WT + MO2-ptger4a standard conditions Fig. 3 with image from Cha et al., 2006
convergent extension involved in gastrulation delayed, abnormal WT + MO2-ptger4a standard conditions Fig. 3 with image from Cha et al., 2006
otic vesicle has extra parts of type otolith, abnormal WT + MO2-ptger4a standard conditions Fig. 5 from Jin et al., 2014
notochord undulate, abnormal WT + MO2-ptger4a standard conditions Fig. 3 with image from Cha et al., 2006
lateral crista has fewer parts of type lateral crista kinocilium, abnormal WT + MO2-ptger4a standard conditions Fig. 5 from Jin et al., 2014
liver EGFP expression decreased distribution, abnormal as3Tg + MO1-ptger4a + MO2-ptger4a control Fig. 1 with image from Nissim et al., 2014
liver EGFP expression amount, ameliorated as3Tg + MO1-ptger4a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 1 with image from Nissim et al., 2014
liver decreased size, abnormal as3Tg + MO1-ptger4a + MO2-ptger4a control Fig. 1 with image from Nissim et al., 2014
liver size, ameliorated as3Tg + MO1-ptger4a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 1 with image from Nissim et al., 2014
exocrine pancreas decreased size, abnormal zf578Tg + MO1-ptger4a + MO2-ptger4a control Fig. 2 with image from Nissim et al., 2014
exocrine pancreas size, ameliorated zf578Tg + MO1-ptger4a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
exocrine pancreas decreased size, abnormal WT + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
exocrine pancreas decreased size, abnormal WT + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a control Fig. 2 with image from Nissim et al., 2014
exocrine pancreas prss1 expression decreased distribution, abnormal WT + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a control Fig. 2 with image from Nissim et al., 2014
exocrine pancreas prss1 expression amount, ameliorated WT + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
liver decreased size, abnormal as3Tg + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 1 with image from Nissim et al., 2014
liver decreased size, abnormal as3Tg + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a control Fig. 1 with image from Nissim et al., 2014
exocrine pancreas decreased size, abnormal zf578Tg + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
exocrine pancreas decreased size, abnormal zf578Tg + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a control Fig. 2 with image from Nissim et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.