Morpholino

MO1-mib1

ID
ZDB-MRPHLNO-051121-1
Name
MO1-mib1
Previous Names
  • ex/int1 (1)
Target
Sequence
5' - GCAGCCTCACCTGTAGGCGCACTGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mib1
Phenotype
Phenotype resulting from MO1-mib1
Phenotype of all Fish created by or utilizing MO1-mib1
Citations